Incidental Mutation 'R4473:Ighv1-49'
ID330466
Institutional Source Beutler Lab
Gene Symbol Ighv1-49
Ensembl Gene ENSMUSG00000076710
Gene Nameimmunoglobulin heavy variable 1-49
SynonymsGm16830
MMRRC Submission 041730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4473 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location115055223-115055656 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115055339 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 79 (Y79N)
Ref Sequence ENSEMBL: ENSMUSP00000141739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103519] [ENSMUST00000192724]
Predicted Effect probably damaging
Transcript: ENSMUST00000103519
AA Change: Y60N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100300
Gene: ENSMUSG00000076710
AA Change: Y60N

DomainStartEndE-ValueType
IGv 17 98 5.3e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192724
AA Change: Y79N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141739
Gene: ENSMUSG00000076710
AA Change: Y79N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 117 2.1e-28 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,206,856 T93K probably damaging Het
Actg1 G A 11: 120,348,259 R2C probably benign Het
Alb T C 5: 90,464,053 C114R probably damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Atp2a2 A T 5: 122,457,264 S1008T probably benign Het
Corin T C 5: 72,339,057 S510G probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Eddm3b A G 14: 51,116,779 T75A probably benign Het
Elavl2 T C 4: 91,261,009 probably null Het
Erc1 G T 6: 119,848,456 probably null Het
Fancf A G 7: 51,862,200 C19R probably benign Het
Fastkd2 T C 1: 63,731,674 L63P probably damaging Het
Fmo1 A G 1: 162,850,163 V128A possibly damaging Het
Gm3106 A G 5: 94,218,170 N49S probably benign Het
Ifnar1 T C 16: 91,495,170 V133A probably damaging Het
Klhl23 A G 2: 69,823,807 E7G possibly damaging Het
Mthfd2 A G 6: 83,310,535 probably benign Het
Olfr1161 T A 2: 88,025,120 Y133N probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Podnl1 A T 8: 84,131,985 I505F possibly damaging Het
Ppp6r3 G T 19: 3,511,978 Q228K probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Skor2 C T 18: 76,859,461 P293S unknown Het
Sox18 T C 2: 181,670,876 K154R probably damaging Het
Tfpi A T 2: 84,458,082 L10Q probably null Het
Trim66 A T 7: 109,481,995 I239N probably damaging Het
Ttll1 T A 15: 83,492,609 K304N probably damaging Het
Vmn1r5 G A 6: 56,985,648 V103I probably benign Het
Vnn1 T C 10: 23,894,891 W6R probably benign Het
Wdr35 A G 12: 9,015,995 Y651C probably benign Het
Other mutations in Ighv1-49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Ighv1-49 APN 12 115055456 missense possibly damaging 0.89
R4945:Ighv1-49 UTSW 12 115055408 missense possibly damaging 0.71
R5436:Ighv1-49 UTSW 12 115055461 missense probably damaging 1.00
R5662:Ighv1-49 UTSW 12 115055407 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGGGAATGCAGCTTGATG -3'
(R):5'- ATGTCACTGATATACACTCTGCC -3'

Sequencing Primer
(F):5'- GCACAGTAATAGACCGCA -3'
(R):5'- AGGAGTCCACTCACAGCGTG -3'
Posted On2015-07-21