Incidental Mutation 'R4473:Eddm3b'
ID330467
Institutional Source Beutler Lab
Gene Symbol Eddm3b
Ensembl Gene ENSMUSG00000072575
Gene Nameepididymal protein 3B
SynonymsFam12
MMRRC Submission 041730-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4473 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location51114426-51117807 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51116779 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 75 (T75A)
Ref Sequence ENSEMBL: ENSMUSP00000098210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100645]
Predicted Effect probably benign
Transcript: ENSMUST00000100645
AA Change: T75A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000098210
Gene: ENSMUSG00000072575
AA Change: T75A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:RnaseA 32 147 1.3e-8 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Testicular sperm are morphologically differentiated but are not progressively motile nor able to fertilize an egg. Post-testicular maturation requires exposure of spermatozoa to the microenvironment of the epididymal lumen. Spermatozoa undergo extensive changes in the epididymis, including enzymatic modifications, loss of pre-existing components and addition of new glycoproteins from epididymal secretions. These modifying proteins and enzymes are synthesized by epithelial cells lining the epididymal duct and secreted apically into the lumen, where they come into contact with, and may be absorbed onto, the sperm membranes. The proteins encoded by the genes in this cluster are synthesized and secreted by epididymal epithelial cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,206,856 T93K probably damaging Het
Actg1 G A 11: 120,348,259 R2C probably benign Het
Alb T C 5: 90,464,053 C114R probably damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Atp2a2 A T 5: 122,457,264 S1008T probably benign Het
Corin T C 5: 72,339,057 S510G probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Elavl2 T C 4: 91,261,009 probably null Het
Erc1 G T 6: 119,848,456 probably null Het
Fancf A G 7: 51,862,200 C19R probably benign Het
Fastkd2 T C 1: 63,731,674 L63P probably damaging Het
Fmo1 A G 1: 162,850,163 V128A possibly damaging Het
Gm3106 A G 5: 94,218,170 N49S probably benign Het
Ifnar1 T C 16: 91,495,170 V133A probably damaging Het
Ighv1-49 A T 12: 115,055,339 Y79N probably damaging Het
Klhl23 A G 2: 69,823,807 E7G possibly damaging Het
Mthfd2 A G 6: 83,310,535 probably benign Het
Olfr1161 T A 2: 88,025,120 Y133N probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Podnl1 A T 8: 84,131,985 I505F possibly damaging Het
Ppp6r3 G T 19: 3,511,978 Q228K probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Skor2 C T 18: 76,859,461 P293S unknown Het
Sox18 T C 2: 181,670,876 K154R probably damaging Het
Tfpi A T 2: 84,458,082 L10Q probably null Het
Trim66 A T 7: 109,481,995 I239N probably damaging Het
Ttll1 T A 15: 83,492,609 K304N probably damaging Het
Vmn1r5 G A 6: 56,985,648 V103I probably benign Het
Vnn1 T C 10: 23,894,891 W6R probably benign Het
Wdr35 A G 12: 9,015,995 Y651C probably benign Het
Other mutations in Eddm3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02025:Eddm3b APN 14 51116771 missense probably damaging 1.00
IGL02084:Eddm3b APN 14 51116630 missense unknown
IGL03371:Eddm3b APN 14 51116965 missense probably damaging 0.97
R1902:Eddm3b UTSW 14 51116864 missense probably damaging 1.00
R5269:Eddm3b UTSW 14 51116721 missense probably damaging 1.00
R7184:Eddm3b UTSW 14 51116930 missense probably damaging 1.00
X0064:Eddm3b UTSW 14 51116999 missense probably damaging 1.00
Z1177:Eddm3b UTSW 14 51116722 missense probably damaging 0.96
Z1177:Eddm3b UTSW 14 51116989 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TCCTCTCTAAAAGCCTGGGC -3'
(R):5'- ATGTCCTCTATGCTGTCGACATAC -3'

Sequencing Primer
(F):5'- TAAAAGCCTGGGCCCTGCTTC -3'
(R):5'- TATGCTGTCGACATACCCATCAG -3'
Posted On2015-07-21