Incidental Mutation 'R4473:Ttll1'
ID330468
Institutional Source Beutler Lab
Gene Symbol Ttll1
Ensembl Gene ENSMUSG00000022442
Gene Nametubulin tyrosine ligase-like 1
Synonyms
MMRRC Submission 041730-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R4473 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location83483769-83510893 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83492609 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 304 (K304N)
Ref Sequence ENSEMBL: ENSMUSP00000105106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016897] [ENSMUST00000109479] [ENSMUST00000109480]
Predicted Effect probably damaging
Transcript: ENSMUST00000016897
AA Change: K304N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000016897
Gene: ENSMUSG00000022442
AA Change: K304N

DomainStartEndE-ValueType
Pfam:TTL 50 364 5.3e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109479
SMART Domains Protein: ENSMUSP00000105105
Gene: ENSMUSG00000022442

DomainStartEndE-ValueType
Pfam:TTL 49 297 1.5e-83 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109480
AA Change: K304N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105106
Gene: ENSMUSG00000022442
AA Change: K304N

DomainStartEndE-ValueType
Pfam:TTL 50 364 6.6e-116 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit short sperm flagellum, abnormal tracheal cilia morphology and function, abnormal mucociliary clearance, and rhinosinitus with coughing or sneezing-like noises. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,206,856 T93K probably damaging Het
Actg1 G A 11: 120,348,259 R2C probably benign Het
Alb T C 5: 90,464,053 C114R probably damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Atp2a2 A T 5: 122,457,264 S1008T probably benign Het
Corin T C 5: 72,339,057 S510G probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Eddm3b A G 14: 51,116,779 T75A probably benign Het
Elavl2 T C 4: 91,261,009 probably null Het
Erc1 G T 6: 119,848,456 probably null Het
Fancf A G 7: 51,862,200 C19R probably benign Het
Fastkd2 T C 1: 63,731,674 L63P probably damaging Het
Fmo1 A G 1: 162,850,163 V128A possibly damaging Het
Gm3106 A G 5: 94,218,170 N49S probably benign Het
Ifnar1 T C 16: 91,495,170 V133A probably damaging Het
Ighv1-49 A T 12: 115,055,339 Y79N probably damaging Het
Klhl23 A G 2: 69,823,807 E7G possibly damaging Het
Mthfd2 A G 6: 83,310,535 probably benign Het
Olfr1161 T A 2: 88,025,120 Y133N probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Podnl1 A T 8: 84,131,985 I505F possibly damaging Het
Ppp6r3 G T 19: 3,511,978 Q228K probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Skor2 C T 18: 76,859,461 P293S unknown Het
Sox18 T C 2: 181,670,876 K154R probably damaging Het
Tfpi A T 2: 84,458,082 L10Q probably null Het
Trim66 A T 7: 109,481,995 I239N probably damaging Het
Vmn1r5 G A 6: 56,985,648 V103I probably benign Het
Vnn1 T C 10: 23,894,891 W6R probably benign Het
Wdr35 A G 12: 9,015,995 Y651C probably benign Het
Other mutations in Ttll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02129:Ttll1 APN 15 83484249 missense probably benign
IGL02744:Ttll1 APN 15 83489577 missense probably benign 0.00
R0639:Ttll1 UTSW 15 83502225 nonsense probably null
R1248:Ttll1 UTSW 15 83502125 missense probably benign 0.13
R1581:Ttll1 UTSW 15 83496277 missense probably damaging 0.99
R1599:Ttll1 UTSW 15 83497354 missense probably benign 0.36
R2264:Ttll1 UTSW 15 83496408 missense probably damaging 1.00
R2923:Ttll1 UTSW 15 83492559 missense probably damaging 0.97
R3786:Ttll1 UTSW 15 83484218 missense probably benign 0.00
R4200:Ttll1 UTSW 15 83492577 missense probably damaging 1.00
R4364:Ttll1 UTSW 15 83499994 missense probably damaging 0.99
R4590:Ttll1 UTSW 15 83497345 missense probably damaging 1.00
R4949:Ttll1 UTSW 15 83502173 missense probably null 1.00
R4970:Ttll1 UTSW 15 83496396 missense probably damaging 1.00
R5112:Ttll1 UTSW 15 83496396 missense probably damaging 1.00
R5231:Ttll1 UTSW 15 83489466 splice site probably null
R5911:Ttll1 UTSW 15 83502281 missense probably benign 0.07
R6368:Ttll1 UTSW 15 83489617 missense probably damaging 1.00
R6636:Ttll1 UTSW 15 83499946 missense probably damaging 1.00
R6959:Ttll1 UTSW 15 83502196 nonsense probably null
R7848:Ttll1 UTSW 15 83497372 missense probably damaging 0.97
R7931:Ttll1 UTSW 15 83497372 missense probably damaging 0.97
Z1088:Ttll1 UTSW 15 83498189 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGACTCACTTCCAAATCATGC -3'
(R):5'- GTTTGAACCTGGTTGCACAG -3'

Sequencing Primer
(F):5'- TCATGCCTTAACACATGCGGG -3'
(R):5'- TGTGCAAATGAGTGTATATGCACGC -3'
Posted On2015-07-21