Incidental Mutation 'R4473:Ifnar1'
ID330470
Institutional Source Beutler Lab
Gene Symbol Ifnar1
Ensembl Gene ENSMUSG00000022967
Gene Nameinterferon (alpha and beta) receptor 1
SynonymsIfar, Ifrc, IFN-alpha/betaR
MMRRC Submission 041730-MU
Accession Numbers

Ncbi RefSeq: NM_010508; VEGA:  OTTMUST00000067225; MGI: 107658;

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4473 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location91485238-91507441 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91495170 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 133 (V133A)
Ref Sequence ENSEMBL: ENSMUSP00000119160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023689] [ENSMUST00000117748] [ENSMUST00000123196] [ENSMUST00000129878] [ENSMUST00000232509]
Predicted Effect probably damaging
Transcript: ENSMUST00000023689
AA Change: V133A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023689
Gene: ENSMUSG00000022967
AA Change: V133A

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
FN3 29 110 6.97e0 SMART
FN3 128 213 7.02e1 SMART
low complexity region 267 275 N/A INTRINSIC
FN3 332 409 3.23e0 SMART
PDB:4PO6|B 469 499 3e-7 PDB
low complexity region 550 562 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117748
AA Change: V133A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112670
Gene: ENSMUSG00000022967
AA Change: V133A

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
FN3 29 110 6.97e0 SMART
FN3 128 213 7.02e1 SMART
low complexity region 267 275 N/A INTRINSIC
FN3 332 409 3.23e0 SMART
PDB:4PO6|B 469 499 3e-7 PDB
low complexity region 550 562 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123196
AA Change: V133A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119160
Gene: ENSMUSG00000022967
AA Change: V133A

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
FN3 29 110 6.97e0 SMART
FN3 128 213 7.02e1 SMART
low complexity region 267 275 N/A INTRINSIC
FN3 332 409 3.23e0 SMART
PDB:4PO6|B 469 499 3e-7 PDB
low complexity region 550 562 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129878
SMART Domains Protein: ENSMUSP00000120945
Gene: ENSMUSG00000022967

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
FN3 29 110 6.97e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231604
Predicted Effect silent
Transcript: ENSMUST00000232509
Meta Mutation Damage Score 0.5639 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. The encoded protein also functions as an antiviral factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased susceptibility to viral infection, elevated levels of myeloid lineage cells in the peripheral blood and bone marrow, and reduced immune response to immunostimulatory DNA. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(5) Gene trapped(4) Chemically induced(1)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,206,856 T93K probably damaging Het
Actg1 G A 11: 120,348,259 R2C probably benign Het
Alb T C 5: 90,464,053 C114R probably damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Atp2a2 A T 5: 122,457,264 S1008T probably benign Het
Corin T C 5: 72,339,057 S510G probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Eddm3b A G 14: 51,116,779 T75A probably benign Het
Elavl2 T C 4: 91,261,009 probably null Het
Erc1 G T 6: 119,848,456 probably null Het
Fancf A G 7: 51,862,200 C19R probably benign Het
Fastkd2 T C 1: 63,731,674 L63P probably damaging Het
Fmo1 A G 1: 162,850,163 V128A possibly damaging Het
Gm3106 A G 5: 94,218,170 N49S probably benign Het
Ighv1-49 A T 12: 115,055,339 Y79N probably damaging Het
Klhl23 A G 2: 69,823,807 E7G possibly damaging Het
Mthfd2 A G 6: 83,310,535 probably benign Het
Olfr1161 T A 2: 88,025,120 Y133N probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Podnl1 A T 8: 84,131,985 I505F possibly damaging Het
Ppp6r3 G T 19: 3,511,978 Q228K probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Skor2 C T 18: 76,859,461 P293S unknown Het
Sox18 T C 2: 181,670,876 K154R probably damaging Het
Tfpi A T 2: 84,458,082 L10Q probably null Het
Trim66 A T 7: 109,481,995 I239N probably damaging Het
Ttll1 T A 15: 83,492,609 K304N probably damaging Het
Vmn1r5 G A 6: 56,985,648 V103I probably benign Het
Vnn1 T C 10: 23,894,891 W6R probably benign Het
Wdr35 A G 12: 9,015,995 Y651C probably benign Het
Other mutations in Ifnar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ifnar1 APN 16 91489782 missense probably damaging 0.99
IGL02183:Ifnar1 APN 16 91505146 missense possibly damaging 0.94
IGL02828:Ifnar1 APN 16 91505416 critical splice donor site probably null
macro-1 UTSW 16 91499885 missense probably damaging 0.98
shook UTSW 16 91499537 nonsense probably null
sneffels UTSW 16 91501620 critical splice acceptor site probably null
R0124:Ifnar1 UTSW 16 91499537 nonsense probably null
R0502:Ifnar1 UTSW 16 91501751 missense probably damaging 1.00
R0617:Ifnar1 UTSW 16 91501682 missense probably damaging 1.00
R1509:Ifnar1 UTSW 16 91503496 missense probably damaging 1.00
R4111:Ifnar1 UTSW 16 91496158 missense probably damaging 1.00
R4964:Ifnar1 UTSW 16 91505086 missense probably benign 0.08
R5497:Ifnar1 UTSW 16 91505364 missense probably benign 0.01
R6135:Ifnar1 UTSW 16 91501620 critical splice acceptor site probably null
R6398:Ifnar1 UTSW 16 91505415 critical splice donor site probably null
R6505:Ifnar1 UTSW 16 91499537 nonsense probably null
R6620:Ifnar1 UTSW 16 91496267 splice site probably null
R7229:Ifnar1 UTSW 16 91499556 missense probably benign 0.00
R7664:Ifnar1 UTSW 16 91495194 missense probably damaging 1.00
X0057:Ifnar1 UTSW 16 91495424 missense probably damaging 0.98
X0057:Ifnar1 UTSW 16 91505283 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTCAGGTTGCTCTTGCCAGG -3'
(R):5'- CTGGCAAGAGTTCTGGTATCTTTTC -3'

Sequencing Primer
(F):5'- CCAGGTCTTCCCAAAGTGTGAAATG -3'
(R):5'- AATTCTTTCACCTCTATTTCTCTCAC -3'
Posted On2015-07-21