Incidental Mutation 'R4473:Ppp6r3'
ID330471
Institutional Source Beutler Lab
Gene Symbol Ppp6r3
Ensembl Gene ENSMUSG00000024908
Gene Nameprotein phosphatase 6, regulatory subunit 3
SynonymsPp6r3, D19Ertd703e, D19Bwg1430e, 4930528G08Rik, Saps3, 9130026N02Rik, Pptcs3
MMRRC Submission 041730-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R4473 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location3454928-3575749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 3511978 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 228 (Q228K)
Ref Sequence ENSEMBL: ENSMUSP00000131084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025846] [ENSMUST00000113997] [ENSMUST00000172362]
Predicted Effect probably damaging
Transcript: ENSMUST00000025846
AA Change: Q228K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025846
Gene: ENSMUSG00000024908
AA Change: Q228K

DomainStartEndE-ValueType
coiled coil region 25 52 N/A INTRINSIC
Pfam:SAPS 128 365 2.7e-69 PFAM
Pfam:SAPS 360 513 1.4e-44 PFAM
low complexity region 609 627 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113997
AA Change: Q228K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109630
Gene: ENSMUSG00000024908
AA Change: Q228K

DomainStartEndE-ValueType
coiled coil region 25 52 N/A INTRINSIC
Pfam:SAPS 128 365 5.8e-69 PFAM
Pfam:SAPS 363 513 2.7e-44 PFAM
low complexity region 638 656 N/A INTRINSIC
low complexity region 772 787 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172362
AA Change: Q228K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131084
Gene: ENSMUSG00000024908
AA Change: Q228K

DomainStartEndE-ValueType
coiled coil region 25 52 N/A INTRINSIC
Pfam:SAPS 128 365 2.6e-69 PFAM
Pfam:SAPS 360 513 1.3e-44 PFAM
low complexity region 592 610 N/A INTRINSIC
low complexity region 726 741 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225446
Meta Mutation Damage Score 0.3938 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase regulatory subunits, such as SAPS3, modulate the activity of protein phosphatase catalytic subunits by restricting substrate specificity, recruiting substrates, and determining the intracellular localization of the holoenzyme. SAPS3 is a regulatory subunit for the protein phosphatase-6 catalytic subunit (PPP6C; MIM 612725) (Stefansson and Brautigan, 2006 [PubMed 16769727]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,206,856 T93K probably damaging Het
Actg1 G A 11: 120,348,259 R2C probably benign Het
Alb T C 5: 90,464,053 C114R probably damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Atp2a2 A T 5: 122,457,264 S1008T probably benign Het
Corin T C 5: 72,339,057 S510G probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Eddm3b A G 14: 51,116,779 T75A probably benign Het
Elavl2 T C 4: 91,261,009 probably null Het
Erc1 G T 6: 119,848,456 probably null Het
Fancf A G 7: 51,862,200 C19R probably benign Het
Fastkd2 T C 1: 63,731,674 L63P probably damaging Het
Fmo1 A G 1: 162,850,163 V128A possibly damaging Het
Gm3106 A G 5: 94,218,170 N49S probably benign Het
Ifnar1 T C 16: 91,495,170 V133A probably damaging Het
Ighv1-49 A T 12: 115,055,339 Y79N probably damaging Het
Klhl23 A G 2: 69,823,807 E7G possibly damaging Het
Mthfd2 A G 6: 83,310,535 probably benign Het
Olfr1161 T A 2: 88,025,120 Y133N probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Podnl1 A T 8: 84,131,985 I505F possibly damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Skor2 C T 18: 76,859,461 P293S unknown Het
Sox18 T C 2: 181,670,876 K154R probably damaging Het
Tfpi A T 2: 84,458,082 L10Q probably null Het
Trim66 A T 7: 109,481,995 I239N probably damaging Het
Ttll1 T A 15: 83,492,609 K304N probably damaging Het
Vmn1r5 G A 6: 56,985,648 V103I probably benign Het
Vnn1 T C 10: 23,894,891 W6R probably benign Het
Wdr35 A G 12: 9,015,995 Y651C probably benign Het
Other mutations in Ppp6r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ppp6r3 APN 19 3514729 splice site probably null
IGL00340:Ppp6r3 APN 19 3518324 missense probably damaging 1.00
IGL00585:Ppp6r3 APN 19 3490826 missense probably damaging 0.99
IGL01304:Ppp6r3 APN 19 3467261 missense probably damaging 0.99
IGL02048:Ppp6r3 APN 19 3473848 missense possibly damaging 0.96
IGL02055:Ppp6r3 APN 19 3521781 missense probably benign 0.01
IGL02108:Ppp6r3 APN 19 3492494 missense probably damaging 1.00
IGL02227:Ppp6r3 APN 19 3518245 missense possibly damaging 0.56
IGL02427:Ppp6r3 APN 19 3466580 missense probably null
IGL02441:Ppp6r3 APN 19 3464693 missense probably benign 0.14
IGL02805:Ppp6r3 APN 19 3492428 missense probably benign 0.15
IGL03298:Ppp6r3 APN 19 3521829 missense probably damaging 0.97
PIT1430001:Ppp6r3 UTSW 19 3471059 nonsense probably null
R0324:Ppp6r3 UTSW 19 3464693 missense probably benign 0.00
R0362:Ppp6r3 UTSW 19 3478285 missense probably damaging 0.96
R1876:Ppp6r3 UTSW 19 3471971 splice site probably benign
R2860:Ppp6r3 UTSW 19 3521782 missense possibly damaging 0.49
R2861:Ppp6r3 UTSW 19 3521782 missense possibly damaging 0.49
R2862:Ppp6r3 UTSW 19 3521782 missense possibly damaging 0.49
R3958:Ppp6r3 UTSW 19 3496583 missense probably damaging 0.99
R4158:Ppp6r3 UTSW 19 3512037 missense probably damaging 0.97
R4160:Ppp6r3 UTSW 19 3512037 missense probably damaging 0.97
R4901:Ppp6r3 UTSW 19 3467229 missense probably damaging 1.00
R4996:Ppp6r3 UTSW 19 3473833 missense probably damaging 0.98
R5139:Ppp6r3 UTSW 19 3464610 missense probably damaging 1.00
R5414:Ppp6r3 UTSW 19 3507330 missense probably damaging 1.00
R5776:Ppp6r3 UTSW 19 3526901 missense possibly damaging 0.77
R6290:Ppp6r3 UTSW 19 3494011 missense probably benign
R6525:Ppp6r3 UTSW 19 3493936 missense probably damaging 0.99
R6797:Ppp6r3 UTSW 19 3514719 missense probably damaging 1.00
R6977:Ppp6r3 UTSW 19 3467272 missense probably damaging 1.00
R7176:Ppp6r3 UTSW 19 3471989 missense probably damaging 0.99
R7178:Ppp6r3 UTSW 19 3518337 missense probably benign 0.00
R7239:Ppp6r3 UTSW 19 3493981 missense probably benign 0.38
R7326:Ppp6r3 UTSW 19 3507325 missense probably damaging 1.00
R7536:Ppp6r3 UTSW 19 3507341 missense possibly damaging 0.80
R7583:Ppp6r3 UTSW 19 3490790 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCTTTCCTGCTTTGCATATG -3'
(R):5'- TACACTGTGCAGTTGTGGAC -3'

Sequencing Primer
(F):5'- CATATGGTTTTCATGACACGGTGCC -3'
(R):5'- GCTCATTAGCCTGGCAGTCAATG -3'
Posted On2015-07-21