Incidental Mutation 'R4473:Siah1b'
ID330472
Institutional Source Beutler Lab
Gene Symbol Siah1b
Ensembl Gene ENSMUSG00000040749
Gene Namesiah E3 ubiquitin protein ligase 1B
SynonymsSinh1b
MMRRC Submission 041730-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.815) question?
Stock #R4473 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location164070705-164076493 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 164071692 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 131 (P131S)
Ref Sequence ENSEMBL: ENSMUSP00000071592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037928] [ENSMUST00000071667] [ENSMUST00000134272]
Predicted Effect probably damaging
Transcript: ENSMUST00000037928
AA Change: P131S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043215
Gene: ENSMUSG00000040749
AA Change: P131S

DomainStartEndE-ValueType
RING 41 75 5.56e-1 SMART
Pfam:Sina 82 278 1.2e-84 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000071667
AA Change: P131S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071592
Gene: ENSMUSG00000040749
AA Change: P131S

DomainStartEndE-ValueType
RING 41 75 5.56e-1 SMART
Pfam:Sina 82 278 1.2e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134272
SMART Domains Protein: ENSMUSP00000114867
Gene: ENSMUSG00000040749

DomainStartEndE-ValueType
SCOP:d1jm7b_ 21 65 1e-7 SMART
Blast:DUF4205 21 66 3e-17 BLAST
Meta Mutation Damage Score 0.8481 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: This gene encodes a member of the seven in absentia homolog (Siah) family of E3 ubiquitin ligase enzymes that catalyze the transfer of ubiquitin to substrate proteins. The encoded protein targets Pard3A (partitioning defective 3A) protein for proteasome-mediated degradation during the exit of cerebellar granule neurons from their germinal zone niche. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Primary mouse embryonic fibroblasts hemizygous for a targeted allele show no apparent alterations in Trp53-mediated responses or mitotic progression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 C A 4: 152,206,856 T93K probably damaging Het
Actg1 G A 11: 120,348,259 R2C probably benign Het
Alb T C 5: 90,464,053 C114R probably damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Atp2a2 A T 5: 122,457,264 S1008T probably benign Het
Corin T C 5: 72,339,057 S510G probably damaging Het
D630003M21Rik G A 2: 158,213,462 P585L probably damaging Het
Eddm3b A G 14: 51,116,779 T75A probably benign Het
Elavl2 T C 4: 91,261,009 probably null Het
Erc1 G T 6: 119,848,456 probably null Het
Fancf A G 7: 51,862,200 C19R probably benign Het
Fastkd2 T C 1: 63,731,674 L63P probably damaging Het
Fmo1 A G 1: 162,850,163 V128A possibly damaging Het
Gm3106 A G 5: 94,218,170 N49S probably benign Het
Ifnar1 T C 16: 91,495,170 V133A probably damaging Het
Ighv1-49 A T 12: 115,055,339 Y79N probably damaging Het
Klhl23 A G 2: 69,823,807 E7G possibly damaging Het
Mthfd2 A G 6: 83,310,535 probably benign Het
Olfr1161 T A 2: 88,025,120 Y133N probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Podnl1 A T 8: 84,131,985 I505F possibly damaging Het
Ppp6r3 G T 19: 3,511,978 Q228K probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Skor2 C T 18: 76,859,461 P293S unknown Het
Sox18 T C 2: 181,670,876 K154R probably damaging Het
Tfpi A T 2: 84,458,082 L10Q probably null Het
Trim66 A T 7: 109,481,995 I239N probably damaging Het
Ttll1 T A 15: 83,492,609 K304N probably damaging Het
Vmn1r5 G A 6: 56,985,648 V103I probably benign Het
Vnn1 T C 10: 23,894,891 W6R probably benign Het
Wdr35 A G 12: 9,015,995 Y651C probably benign Het
Other mutations in Siah1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4435:Siah1b UTSW X 164071692 missense probably damaging 1.00
R4436:Siah1b UTSW X 164071692 missense probably damaging 1.00
R4437:Siah1b UTSW X 164071692 missense probably damaging 1.00
R4438:Siah1b UTSW X 164071692 missense probably damaging 1.00
R4474:Siah1b UTSW X 164071692 missense probably damaging 1.00
R4475:Siah1b UTSW X 164071692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGTTTCTCCAAGACTAACATG -3'
(R):5'- TTTGTAGCAACTGTCGCCCC -3'

Sequencing Primer
(F):5'- TGTTTCTCCAAGACTAACATGAAATG -3'
(R):5'- GTCGCCCCAAACTTACATGTTG -3'
Posted On2015-07-21