Incidental Mutation 'R4474:Olfr1305'
ID330476
Institutional Source Beutler Lab
Gene Symbol Olfr1305
Ensembl Gene ENSMUSG00000074955
Gene Nameolfactory receptor 1305
SynonymsMOR245-8, GA_x6K02T2Q125-72930843-72929905
MMRRC Submission 041731-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R4474 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111867657-111877149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 111873439 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 139 (R139W)
Ref Sequence ENSEMBL: ENSMUSP00000149852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099608] [ENSMUST00000213405] [ENSMUST00000213737]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099608
AA Change: R139W

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097203
Gene: ENSMUSG00000074955
AA Change: R139W

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.4e-41 PFAM
Pfam:7TM_GPCR_Srsx 35 302 6.8e-7 PFAM
Pfam:7tm_1 41 287 4.1e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213405
AA Change: R139W

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213737
AA Change: R139W

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216310
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,233,772 I397K possibly damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Cdh23 G T 10: 60,311,086 A2795D probably damaging Het
Cdk19 G A 10: 40,469,956 probably null Het
Cep104 T A 4: 153,989,236 M476K possibly damaging Het
Csf1 T C 3: 107,753,856 D115G probably damaging Het
Dclre1b C A 3: 103,807,243 probably benign Het
Fbp1 A G 13: 62,875,261 L74P probably damaging Het
Gm9573 G T 17: 35,620,604 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hydin G T 8: 110,563,865 V3319L probably benign Het
Kcna4 A G 2: 107,296,007 N362S probably benign Het
Kif13a C T 13: 46,814,155 probably null Het
Lingo2 T C 4: 35,708,810 E390G probably benign Het
Mdh1 T G 11: 21,566,624 D33A possibly damaging Het
Mov10 C T 3: 104,818,465 G21D probably damaging Het
Olfr851 T A 9: 19,496,877 L43Q probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Pik3c2g T A 6: 139,633,751 Y332N probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Rims2 A G 15: 39,462,560 S763G probably damaging Het
Sarm1 T A 11: 78,497,101 I120L probably benign Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Snx31 A G 15: 36,546,111 probably benign Het
Tmem150a C T 6: 72,357,052 S39F probably benign Het
Tsc2 T A 17: 24,597,264 H1605L probably damaging Het
Ugt1a10 TAAAAAAAAA TAAAAAAA 1: 88,215,928 probably benign Het
Vmn2r95 T C 17: 18,452,245 L820P probably damaging Het
Zfp36l3 T C X: 53,775,957 N97D possibly damaging Het
Other mutations in Olfr1305
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Olfr1305 APN 2 111872950 missense probably benign 0.03
IGL02198:Olfr1305 APN 2 111873248 missense probably damaging 1.00
IGL02277:Olfr1305 APN 2 111873580 missense possibly damaging 0.91
IGL02302:Olfr1305 APN 2 111873542 missense possibly damaging 0.76
IGL03348:Olfr1305 APN 2 111873148 missense probably damaging 0.99
PIT4131001:Olfr1305 UTSW 2 111873304 missense probably benign 0.02
R2144:Olfr1305 UTSW 2 111873423 missense probably damaging 0.96
R2860:Olfr1305 UTSW 2 111873473 nonsense probably null
R2861:Olfr1305 UTSW 2 111873473 nonsense probably null
R3785:Olfr1305 UTSW 2 111873486 missense probably damaging 0.99
R4508:Olfr1305 UTSW 2 111873602 missense probably damaging 1.00
R4540:Olfr1305 UTSW 2 111873201 missense probably damaging 1.00
R4783:Olfr1305 UTSW 2 111873050 missense possibly damaging 0.95
R4784:Olfr1305 UTSW 2 111873050 missense possibly damaging 0.95
R4785:Olfr1305 UTSW 2 111873050 missense possibly damaging 0.95
R5410:Olfr1305 UTSW 2 111873292 missense probably damaging 1.00
R5491:Olfr1305 UTSW 2 111873562 missense probably benign 0.44
R6875:Olfr1305 UTSW 2 111872961 missense possibly damaging 0.92
R7185:Olfr1305 UTSW 2 111873822 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGAAATGAACCCACTATTGGCAG -3'
(R):5'- GTTCCATTGCAGCACCCAAAATG -3'

Sequencing Primer
(F):5'- TGGCAGTAATCATGAGCTCC -3'
(R):5'- GCAGCACCCAAAATGATTTGTG -3'
Posted On2015-07-21