Incidental Mutation 'R4474:Dclre1b'
ID330479
Institutional Source Beutler Lab
Gene Symbol Dclre1b
Ensembl Gene ENSMUSG00000027845
Gene NameDNA cross-link repair 1B
SynonymsSNMIB, Apollo, mSNM1B
MMRRC Submission 041731-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4474 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location103800605-103809444 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 103807243 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029435] [ENSMUST00000047285] [ENSMUST00000063502] [ENSMUST00000076599] [ENSMUST00000106823] [ENSMUST00000106824] [ENSMUST00000106832] [ENSMUST00000106834] [ENSMUST00000128716] [ENSMUST00000198752] [ENSMUST00000199710] [ENSMUST00000200377]
Predicted Effect probably benign
Transcript: ENSMUST00000029435
SMART Domains Protein: ENSMUSP00000029435
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Pfam:DRMBL 215 301 1e-13 PFAM
PDB:3BUA|H 492 526 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000047285
SMART Domains Protein: ENSMUSP00000044262
Gene: ENSMUSG00000032952

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 525 7e-94 PFAM
Pfam:Cnd1 98 269 2.4e-11 PFAM
B2-adapt-app_C 619 731 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063502
SMART Domains Protein: ENSMUSP00000067695
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Blast:Lactamase_B 1 49 4e-24 BLAST
Pfam:DRMBL 89 176 7.4e-20 PFAM
PDB:3BUA|H 366 400 8e-11 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000076599
SMART Domains Protein: ENSMUSP00000075904
Gene: ENSMUSG00000032952

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 525 1e-93 PFAM
Pfam:Cnd1 98 286 3.9e-10 PFAM
B2-adapt-app_C 619 731 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106823
SMART Domains Protein: ENSMUSP00000102436
Gene: ENSMUSG00000032952

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 374 2e-68 PFAM
Pfam:Cnd1 98 285 1.4e-10 PFAM
Pfam:Adaptin_N 371 497 5.2e-16 PFAM
B2-adapt-app_C 591 703 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106824
SMART Domains Protein: ENSMUSP00000102437
Gene: ENSMUSG00000032952

DomainStartEndE-ValueType
Pfam:Cnd1 35 212 5e-9 PFAM
Pfam:Adaptin_N 35 450 1.2e-62 PFAM
B2-adapt-app_C 544 656 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106832
SMART Domains Protein: ENSMUSP00000102445
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106834
SMART Domains Protein: ENSMUSP00000102447
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Pfam:DRMBL 215 302 7.9e-20 PFAM
PDB:3BUA|H 492 526 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000128716
SMART Domains Protein: ENSMUSP00000121063
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Blast:Lactamase_B 1 63 3e-40 BLAST
PDB:3ZDK|A 1 63 3e-34 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149374
Predicted Effect probably benign
Transcript: ENSMUST00000198752
SMART Domains Protein: ENSMUSP00000143067
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Blast:Lactamase_B 1 93 2e-64 BLAST
PDB:3ZDK|A 1 97 1e-62 PDB
SCOP:d1a7ta_ 3 93 5e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198835
Predicted Effect probably benign
Transcript: ENSMUST00000199710
SMART Domains Protein: ENSMUSP00000143463
Gene: ENSMUSG00000105053

DomainStartEndE-ValueType
Pfam:Cnd1 35 212 5e-9 PFAM
Pfam:Adaptin_N 35 450 1.2e-62 PFAM
B2-adapt-app_C 544 656 3.75e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199723
Predicted Effect probably benign
Transcript: ENSMUST00000200377
SMART Domains Protein: ENSMUSP00000143355
Gene: ENSMUSG00000032952

DomainStartEndE-ValueType
Pfam:Adaptin_N 7 357 2.9e-45 PFAM
B2-adapt-app_C 451 563 2.8e-46 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA interstrand cross-links prevent strand separation, thereby physically blocking transcription, replication, and segregation of DNA. DCLRE1B is one of several evolutionarily conserved genes involved in repair of interstrand cross-links (Dronkert et al., 2000 [PubMed 10848582]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced embryo size and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,233,772 I397K possibly damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Cdh23 G T 10: 60,311,086 A2795D probably damaging Het
Cdk19 G A 10: 40,469,956 probably null Het
Cep104 T A 4: 153,989,236 M476K possibly damaging Het
Csf1 T C 3: 107,753,856 D115G probably damaging Het
Fbp1 A G 13: 62,875,261 L74P probably damaging Het
Gm9573 G T 17: 35,620,604 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hydin G T 8: 110,563,865 V3319L probably benign Het
Kcna4 A G 2: 107,296,007 N362S probably benign Het
Kif13a C T 13: 46,814,155 probably null Het
Lingo2 T C 4: 35,708,810 E390G probably benign Het
Mdh1 T G 11: 21,566,624 D33A possibly damaging Het
Mov10 C T 3: 104,818,465 G21D probably damaging Het
Olfr1305 G A 2: 111,873,439 R139W possibly damaging Het
Olfr851 T A 9: 19,496,877 L43Q probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Pik3c2g T A 6: 139,633,751 Y332N probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Rims2 A G 15: 39,462,560 S763G probably damaging Het
Sarm1 T A 11: 78,497,101 I120L probably benign Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Snx31 A G 15: 36,546,111 probably benign Het
Tmem150a C T 6: 72,357,052 S39F probably benign Het
Tsc2 T A 17: 24,597,264 H1605L probably damaging Het
Ugt1a10 TAAAAAAAAA TAAAAAAA 1: 88,215,928 probably benign Het
Vmn2r95 T C 17: 18,452,245 L820P probably damaging Het
Zfp36l3 T C X: 53,775,957 N97D possibly damaging Het
Other mutations in Dclre1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Dclre1b APN 3 103803126 missense probably benign
IGL01411:Dclre1b APN 3 103803323 missense probably damaging 1.00
IGL02311:Dclre1b APN 3 103808093 missense probably damaging 1.00
IGL03250:Dclre1b APN 3 103804064 unclassified probably null
IGL03410:Dclre1b APN 3 103808140 missense probably damaging 1.00
IGL03046:Dclre1b UTSW 3 103803281 missense probably benign 0.00
R0022:Dclre1b UTSW 3 103803148 missense probably benign 0.03
R0022:Dclre1b UTSW 3 103803148 missense probably benign 0.03
R1173:Dclre1b UTSW 3 103803876 missense probably benign 0.00
R1997:Dclre1b UTSW 3 103803356 missense probably benign 0.02
R2051:Dclre1b UTSW 3 103809040 missense possibly damaging 0.68
R2914:Dclre1b UTSW 3 103808114 missense probably damaging 0.98
R3420:Dclre1b UTSW 3 103808096 missense probably damaging 1.00
R4247:Dclre1b UTSW 3 103804084 intron probably null
R4250:Dclre1b UTSW 3 103804084 intron probably null
R4866:Dclre1b UTSW 3 103808096 missense probably damaging 0.99
R5098:Dclre1b UTSW 3 103809136 unclassified probably benign
R5375:Dclre1b UTSW 3 103803974 missense probably damaging 1.00
R5796:Dclre1b UTSW 3 103807457 nonsense probably null
R5888:Dclre1b UTSW 3 103803737 missense probably damaging 1.00
R6189:Dclre1b UTSW 3 103803533 missense probably damaging 1.00
R6356:Dclre1b UTSW 3 103808155 missense probably damaging 1.00
R6443:Dclre1b UTSW 3 103803188 missense possibly damaging 0.82
R7471:Dclre1b UTSW 3 103803114 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTGCGGGATATAGCAGCAG -3'
(R):5'- CAGCTAATCCGACAGTTCCC -3'

Sequencing Primer
(F):5'- TTTAATTAACGACAAAGCTGGGG -3'
(R):5'- CACAACACAACATAAAAATTGGTGAG -3'
Posted On2015-07-21