Incidental Mutation 'R4474:Csf1'
ID330481
Institutional Source Beutler Lab
Gene Symbol Csf1
Ensembl Gene ENSMUSG00000014599
Gene Namecolony stimulating factor 1 (macrophage)
Synonymscolony-stimulating factor-1, CSF-1, Csfm, M-CSF
MMRRC Submission 041731-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.815) question?
Stock #R4474 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location107741048-107760469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107753856 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 115 (D115G)
Ref Sequence ENSEMBL: ENSMUSP00000115480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014743] [ENSMUST00000118593] [ENSMUST00000120243] [ENSMUST00000120654] [ENSMUST00000153114] [ENSMUST00000156820]
Predicted Effect probably benign
Transcript: ENSMUST00000014743
AA Change: D91G

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000014743
Gene: ENSMUSG00000014599
AA Change: D91G

DomainStartEndE-ValueType
Pfam:CSF-1 1 254 6.8e-91 PFAM
Pfam:CSF-1 272 552 1.1e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118593
AA Change: D91G

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113136
Gene: ENSMUSG00000014599
AA Change: D91G

DomainStartEndE-ValueType
Pfam:CSF-1 1 257 9.5e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120243
AA Change: D91G

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113617
Gene: ENSMUSG00000014599
AA Change: D91G

DomainStartEndE-ValueType
Pfam:CSF-1 1 254 6.8e-91 PFAM
Pfam:CSF-1 272 552 1.1e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120654
SMART Domains Protein: ENSMUSP00000112832
Gene: ENSMUSG00000014599

DomainStartEndE-ValueType
Pfam:CSF-1 31 163 1.7e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153114
AA Change: D115G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115480
Gene: ENSMUSG00000014599
AA Change: D115G

DomainStartEndE-ValueType
Pfam:CSF-1 26 182 1.1e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155557
Predicted Effect probably benign
Transcript: ENSMUST00000156820
SMART Domains Protein: ENSMUSP00000119553
Gene: ENSMUSG00000014599

DomainStartEndE-ValueType
Pfam:CSF-1 15 142 6e-37 PFAM
Pfam:CSF-1 160 279 4.9e-52 PFAM
Meta Mutation Damage Score 0.5715 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that controls the production, differentiation, and function of macrophages. The active form of the protein is found extracellularly as a disulfide-linked homodimer, and is thought to be produced by proteolytic cleavage of membrane-bound precursors. The encoded protein may be involved in development of the placenta. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit lack of incisors, a broad domed skull, short thick limb bones with reduced marrow cavities, impaired hearing and vision, and reduced fertility in females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,233,772 I397K possibly damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Cdh23 G T 10: 60,311,086 A2795D probably damaging Het
Cdk19 G A 10: 40,469,956 probably null Het
Cep104 T A 4: 153,989,236 M476K possibly damaging Het
Dclre1b C A 3: 103,807,243 probably benign Het
Fbp1 A G 13: 62,875,261 L74P probably damaging Het
Gm9573 G T 17: 35,620,604 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hydin G T 8: 110,563,865 V3319L probably benign Het
Kcna4 A G 2: 107,296,007 N362S probably benign Het
Kif13a C T 13: 46,814,155 probably null Het
Lingo2 T C 4: 35,708,810 E390G probably benign Het
Mdh1 T G 11: 21,566,624 D33A possibly damaging Het
Mov10 C T 3: 104,818,465 G21D probably damaging Het
Olfr1305 G A 2: 111,873,439 R139W possibly damaging Het
Olfr851 T A 9: 19,496,877 L43Q probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Pik3c2g T A 6: 139,633,751 Y332N probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Rims2 A G 15: 39,462,560 S763G probably damaging Het
Sarm1 T A 11: 78,497,101 I120L probably benign Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Snx31 A G 15: 36,546,111 probably benign Het
Tmem150a C T 6: 72,357,052 S39F probably benign Het
Tsc2 T A 17: 24,597,264 H1605L probably damaging Het
Ugt1a10 TAAAAAAAAA TAAAAAAA 1: 88,215,928 probably benign Het
Vmn2r95 T C 17: 18,452,245 L820P probably damaging Het
Zfp36l3 T C X: 53,775,957 N97D possibly damaging Het
Other mutations in Csf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Csf1 APN 3 107756727 missense probably benign 0.00
IGL00907:Csf1 APN 3 107750346 missense probably damaging 1.00
IGL01644:Csf1 APN 3 107753842 missense possibly damaging 0.84
R0022:Csf1 UTSW 3 107753862 missense probably damaging 0.99
R0025:Csf1 UTSW 3 107748644 missense probably benign
R0025:Csf1 UTSW 3 107748644 missense probably benign
R0350:Csf1 UTSW 3 107748606 missense probably benign 0.01
R1392:Csf1 UTSW 3 107756630 missense probably benign 0.03
R1392:Csf1 UTSW 3 107756630 missense probably benign 0.03
R1531:Csf1 UTSW 3 107748338 missense possibly damaging 0.72
R1897:Csf1 UTSW 3 107748279 missense probably damaging 1.00
R4373:Csf1 UTSW 3 107756739 missense probably damaging 1.00
R4375:Csf1 UTSW 3 107756739 missense probably damaging 1.00
R4376:Csf1 UTSW 3 107756739 missense probably damaging 1.00
R4377:Csf1 UTSW 3 107756739 missense probably damaging 1.00
R4469:Csf1 UTSW 3 107750681 critical splice donor site probably null
R4604:Csf1 UTSW 3 107756962 intron probably null
R4634:Csf1 UTSW 3 107749167 missense probably damaging 0.96
R5086:Csf1 UTSW 3 107748710 missense possibly damaging 0.72
R5156:Csf1 UTSW 3 107748936 missense probably benign 0.01
R5425:Csf1 UTSW 3 107748896 missense possibly damaging 0.96
R6120:Csf1 UTSW 3 107753854 missense probably damaging 0.96
R6268:Csf1 UTSW 3 107747157 missense possibly damaging 0.86
R6269:Csf1 UTSW 3 107749001 missense probably benign 0.04
R6273:Csf1 UTSW 3 107749163 missense probably damaging 1.00
R6298:Csf1 UTSW 3 107748359 missense possibly damaging 0.96
R7196:Csf1 UTSW 3 107753898 missense possibly damaging 0.91
R7375:Csf1 UTSW 3 107748179 missense possibly damaging 0.96
R7437:Csf1 UTSW 3 107750756 missense probably benign 0.00
R7464:Csf1 UTSW 3 107748875 missense probably benign 0.03
R7780:Csf1 UTSW 3 107750393 missense probably damaging 0.96
R7808:Csf1 UTSW 3 107760045 missense possibly damaging 0.70
Z1177:Csf1 UTSW 3 107749080 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- AGTTAGTAAGGTTCAGGCTCG -3'
(R):5'- TCCCTTCCTCAGATTACAGGG -3'

Sequencing Primer
(F):5'- CTCGGTGAGCATATGAGGC -3'
(R):5'- CTTCCTCAGATTACAGGGTGACAG -3'
Posted On2015-07-21