Incidental Mutation 'R4474:Lingo2'
ID330483
Institutional Source Beutler Lab
Gene Symbol Lingo2
Ensembl Gene ENSMUSG00000045083
Gene Nameleucine rich repeat and Ig domain containing 2
SynonymsLrrn6c, LERN3, B230217C06Rik
MMRRC Submission 041731-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R4474 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location35706647-36951747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35708810 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 390 (E390G)
Ref Sequence ENSEMBL: ENSMUSP00000130423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065173] [ENSMUST00000098151] [ENSMUST00000108122] [ENSMUST00000108124] [ENSMUST00000164772]
Predicted Effect probably benign
Transcript: ENSMUST00000065173
AA Change: E390G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069772
Gene: ENSMUSG00000045083
AA Change: E390G

DomainStartEndE-ValueType
LRRNT 27 61 1.86e-4 SMART
LRR 80 103 5.89e1 SMART
LRR_TYP 104 127 8.22e-2 SMART
LRR 128 151 6.57e-1 SMART
LRR 152 175 1.31e0 SMART
LRR 176 199 4.83e0 SMART
LRR 200 223 1.62e2 SMART
low complexity region 249 263 N/A INTRINSIC
LRR 272 295 2.17e-1 SMART
LRR 296 319 8.01e0 SMART
LRR_TYP 320 343 7.15e-2 SMART
LRRCT 355 408 3.7e-2 SMART
IGc2 423 490 9.99e-13 SMART
transmembrane domain 543 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098151
AA Change: E390G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095754
Gene: ENSMUSG00000045083
AA Change: E390G

DomainStartEndE-ValueType
LRRNT 27 61 1.86e-4 SMART
LRR 80 103 5.89e1 SMART
LRR_TYP 104 127 8.22e-2 SMART
LRR 128 151 6.57e-1 SMART
LRR 152 175 1.31e0 SMART
LRR 176 199 4.83e0 SMART
LRR 200 223 1.62e2 SMART
low complexity region 249 263 N/A INTRINSIC
LRR 272 295 2.17e-1 SMART
LRR 296 319 8.01e0 SMART
LRR_TYP 320 343 7.15e-2 SMART
LRRCT 355 408 3.7e-2 SMART
IGc2 423 490 9.99e-13 SMART
transmembrane domain 543 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108122
AA Change: E390G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103757
Gene: ENSMUSG00000045083
AA Change: E390G

DomainStartEndE-ValueType
LRRNT 27 61 1.86e-4 SMART
LRR 80 103 5.89e1 SMART
LRR_TYP 104 127 8.22e-2 SMART
LRR 128 151 6.57e-1 SMART
LRR 152 175 1.31e0 SMART
LRR 176 199 4.83e0 SMART
LRR 200 223 1.62e2 SMART
low complexity region 249 263 N/A INTRINSIC
LRR 272 295 2.17e-1 SMART
LRR 296 319 8.01e0 SMART
LRR_TYP 320 343 7.15e-2 SMART
LRRCT 355 408 3.7e-2 SMART
IGc2 423 490 9.99e-13 SMART
transmembrane domain 543 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108124
AA Change: E390G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103759
Gene: ENSMUSG00000045083
AA Change: E390G

DomainStartEndE-ValueType
LRRNT 27 61 1.86e-4 SMART
LRR 80 103 5.89e1 SMART
LRR_TYP 104 127 8.22e-2 SMART
LRR 128 151 6.57e-1 SMART
LRR 152 175 1.31e0 SMART
LRR 176 199 4.83e0 SMART
LRR 200 223 1.62e2 SMART
low complexity region 249 263 N/A INTRINSIC
LRR 272 295 2.17e-1 SMART
LRR 296 319 8.01e0 SMART
LRR_TYP 320 343 7.15e-2 SMART
LRRCT 355 408 3.7e-2 SMART
IGc2 423 490 9.99e-13 SMART
transmembrane domain 543 565 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164772
AA Change: E390G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130423
Gene: ENSMUSG00000045083
AA Change: E390G

DomainStartEndE-ValueType
LRRNT 27 61 1.86e-4 SMART
LRR 80 103 5.89e1 SMART
LRR_TYP 104 127 8.22e-2 SMART
LRR 128 151 6.57e-1 SMART
LRR 152 175 1.31e0 SMART
LRR 176 199 4.83e0 SMART
LRR 200 223 1.62e2 SMART
low complexity region 249 263 N/A INTRINSIC
LRR 272 295 2.17e-1 SMART
LRR 296 319 8.01e0 SMART
LRR_TYP 320 343 7.15e-2 SMART
LRRCT 355 408 3.7e-2 SMART
IGc2 423 490 9.99e-13 SMART
transmembrane domain 543 565 N/A INTRINSIC
Meta Mutation Damage Score 0.1003 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 95% (36/38)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,233,772 I397K possibly damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Cdh23 G T 10: 60,311,086 A2795D probably damaging Het
Cdk19 G A 10: 40,469,956 probably null Het
Cep104 T A 4: 153,989,236 M476K possibly damaging Het
Csf1 T C 3: 107,753,856 D115G probably damaging Het
Dclre1b C A 3: 103,807,243 probably benign Het
Fbp1 A G 13: 62,875,261 L74P probably damaging Het
Gm9573 G T 17: 35,620,604 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hydin G T 8: 110,563,865 V3319L probably benign Het
Kcna4 A G 2: 107,296,007 N362S probably benign Het
Kif13a C T 13: 46,814,155 probably null Het
Mdh1 T G 11: 21,566,624 D33A possibly damaging Het
Mov10 C T 3: 104,818,465 G21D probably damaging Het
Olfr1305 G A 2: 111,873,439 R139W possibly damaging Het
Olfr851 T A 9: 19,496,877 L43Q probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Pik3c2g T A 6: 139,633,751 Y332N probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Rims2 A G 15: 39,462,560 S763G probably damaging Het
Sarm1 T A 11: 78,497,101 I120L probably benign Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Snx31 A G 15: 36,546,111 probably benign Het
Tmem150a C T 6: 72,357,052 S39F probably benign Het
Tsc2 T A 17: 24,597,264 H1605L probably damaging Het
Ugt1a10 TAAAAAAAAA TAAAAAAA 1: 88,215,928 probably benign Het
Vmn2r95 T C 17: 18,452,245 L820P probably damaging Het
Zfp36l3 T C X: 53,775,957 N97D possibly damaging Het
Other mutations in Lingo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01861:Lingo2 APN 4 35709526 missense probably benign 0.31
IGL02532:Lingo2 APN 4 35709171 missense possibly damaging 0.69
IGL02999:Lingo2 APN 4 35708744 missense probably damaging 1.00
R0077:Lingo2 UTSW 4 35708375 missense possibly damaging 0.51
R0669:Lingo2 UTSW 4 35709120 missense probably benign 0.00
R1195:Lingo2 UTSW 4 35708538 missense probably damaging 1.00
R1195:Lingo2 UTSW 4 35708538 missense probably damaging 1.00
R1195:Lingo2 UTSW 4 35708538 missense probably damaging 1.00
R1403:Lingo2 UTSW 4 35709420 missense possibly damaging 0.83
R1403:Lingo2 UTSW 4 35709420 missense possibly damaging 0.83
R1552:Lingo2 UTSW 4 35708315 missense probably damaging 0.99
R2066:Lingo2 UTSW 4 35709179 missense probably benign
R4207:Lingo2 UTSW 4 35709810 missense probably benign 0.01
R4208:Lingo2 UTSW 4 35709810 missense probably benign 0.01
R4326:Lingo2 UTSW 4 35708462 missense probably damaging 1.00
R4327:Lingo2 UTSW 4 35708462 missense probably damaging 1.00
R4328:Lingo2 UTSW 4 35708462 missense probably damaging 1.00
R6801:Lingo2 UTSW 4 35709566 missense probably damaging 0.97
R7343:Lingo2 UTSW 4 35709450 missense possibly damaging 0.88
R7629:Lingo2 UTSW 4 35708675 missense possibly damaging 0.88
R7740:Lingo2 UTSW 4 35709248 missense probably damaging 0.98
R7867:Lingo2 UTSW 4 35709302 missense probably benign
R7950:Lingo2 UTSW 4 35709302 missense probably benign
R7995:Lingo2 UTSW 4 35709425 missense probably damaging 1.00
Z1177:Lingo2 UTSW 4 35709656 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGTCACCCAGGAAATCACGG -3'
(R):5'- GCACTATTGAGCCTCACTCC -3'

Sequencing Primer
(F):5'- CAGGAAATCACGGGCTGC -3'
(R):5'- CAATGTATCTCAGAACCTGCTGG -3'
Posted On2015-07-21