Incidental Mutation 'R4474:Olfr851'
ID330488
Institutional Source Beutler Lab
Gene Symbol Olfr851
Ensembl Gene ENSMUSG00000052625
Gene Nameolfactory receptor 851
SynonymsGA_x6K02T2PVTD-13234278-13235216, MOR155-1
MMRRC Submission 041731-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R4474 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location19493295-19502815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19496877 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 43 (L43Q)
Ref Sequence ENSEMBL: ENSMUSP00000149033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064582] [ENSMUST00000214130]
Predicted Effect probably damaging
Transcript: ENSMUST00000064582
AA Change: L43Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066500
Gene: ENSMUSG00000052625
AA Change: L43Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.1e-54 PFAM
Pfam:7tm_1 41 290 1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214130
AA Change: L43Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6589 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,233,772 I397K possibly damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Cdh23 G T 10: 60,311,086 A2795D probably damaging Het
Cdk19 G A 10: 40,469,956 probably null Het
Cep104 T A 4: 153,989,236 M476K possibly damaging Het
Csf1 T C 3: 107,753,856 D115G probably damaging Het
Dclre1b C A 3: 103,807,243 probably benign Het
Fbp1 A G 13: 62,875,261 L74P probably damaging Het
Gm9573 G T 17: 35,620,604 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hydin G T 8: 110,563,865 V3319L probably benign Het
Kcna4 A G 2: 107,296,007 N362S probably benign Het
Kif13a C T 13: 46,814,155 probably null Het
Lingo2 T C 4: 35,708,810 E390G probably benign Het
Mdh1 T G 11: 21,566,624 D33A possibly damaging Het
Mov10 C T 3: 104,818,465 G21D probably damaging Het
Olfr1305 G A 2: 111,873,439 R139W possibly damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Pik3c2g T A 6: 139,633,751 Y332N probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Rims2 A G 15: 39,462,560 S763G probably damaging Het
Sarm1 T A 11: 78,497,101 I120L probably benign Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Snx31 A G 15: 36,546,111 probably benign Het
Tmem150a C T 6: 72,357,052 S39F probably benign Het
Tsc2 T A 17: 24,597,264 H1605L probably damaging Het
Ugt1a10 TAAAAAAAAA TAAAAAAA 1: 88,215,928 probably benign Het
Vmn2r95 T C 17: 18,452,245 L820P probably damaging Het
Zfp36l3 T C X: 53,775,957 N97D possibly damaging Het
Other mutations in Olfr851
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Olfr851 APN 9 19496859 missense probably damaging 1.00
IGL01992:Olfr851 APN 9 19496774 missense probably benign 0.00
IGL02455:Olfr851 APN 9 19497263 nonsense probably null
IGL02468:Olfr851 APN 9 19497177 missense probably benign
IGL02685:Olfr851 APN 9 19496802 missense probably benign
R0153:Olfr851 UTSW 9 19496937 missense probably damaging 1.00
R0789:Olfr851 UTSW 9 19497162 missense possibly damaging 0.68
R2041:Olfr851 UTSW 9 19496835 missense probably benign
R2060:Olfr851 UTSW 9 19497237 missense possibly damaging 0.88
R5081:Olfr851 UTSW 9 19497261 missense probably benign 0.05
R6853:Olfr851 UTSW 9 19496806 nonsense probably null
R7150:Olfr851 UTSW 9 19496849 missense probably benign 0.44
R7378:Olfr851 UTSW 9 19497102 missense probably damaging 1.00
R7456:Olfr851 UTSW 9 19497548 missense probably damaging 1.00
R7527:Olfr851 UTSW 9 19497389 missense probably damaging 0.98
R7587:Olfr851 UTSW 9 19497522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTCCAAGCTTCAGTGAGAAC -3'
(R):5'- CTGAGACAAGCAGCCTATATAAGTG -3'

Sequencing Primer
(F):5'- CTGTCCTATATTAATGTGGTATTG -3'
(R):5'- AGCAGCCTATATAAGTGATGCTCTGG -3'
Posted On2015-07-21