Incidental Mutation 'R4474:Cdk19'
ID330490
Institutional Source Beutler Lab
Gene Symbol Cdk19
Ensembl Gene ENSMUSG00000038481
Gene Namecyclin-dependent kinase 19
SynonymsCdc2l6, 2700084L06Rik
MMRRC Submission 041731-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4474 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location40339564-40483818 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 40469956 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044672] [ENSMUST00000095743] [ENSMUST00000214659] [ENSMUST00000215000]
Predicted Effect probably null
Transcript: ENSMUST00000044672
SMART Domains Protein: ENSMUSP00000040936
Gene: ENSMUSG00000038481

DomainStartEndE-ValueType
S_TKc 21 335 9.96e-83 SMART
low complexity region 371 405 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
low complexity region 467 499 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000095743
SMART Domains Protein: ENSMUSP00000093414
Gene: ENSMUSG00000038481

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 22 172 7.2e-17 PFAM
Pfam:Pkinase 23 166 2.5e-29 PFAM
Pfam:Pkinase 164 291 1.2e-11 PFAM
low complexity region 327 361 N/A INTRINSIC
low complexity region 363 378 N/A INTRINSIC
low complexity region 423 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214659
Predicted Effect probably benign
Transcript: ENSMUST00000215000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216736
Meta Mutation Damage Score 0.9487 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of the components of the Mediator co-activator complex. The Mediator complex is a multi-protein complex required for transcriptional activation by DNA binding transcription factors of genes transcribed by RNA polymerase II. The protein encoded by this gene is similar to cyclin-dependent kinase 8 which can also be a component of the Mediator complex. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,233,772 I397K possibly damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Cdh23 G T 10: 60,311,086 A2795D probably damaging Het
Cep104 T A 4: 153,989,236 M476K possibly damaging Het
Csf1 T C 3: 107,753,856 D115G probably damaging Het
Dclre1b C A 3: 103,807,243 probably benign Het
Fbp1 A G 13: 62,875,261 L74P probably damaging Het
Gm9573 G T 17: 35,620,604 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hydin G T 8: 110,563,865 V3319L probably benign Het
Kcna4 A G 2: 107,296,007 N362S probably benign Het
Kif13a C T 13: 46,814,155 probably null Het
Lingo2 T C 4: 35,708,810 E390G probably benign Het
Mdh1 T G 11: 21,566,624 D33A possibly damaging Het
Mov10 C T 3: 104,818,465 G21D probably damaging Het
Olfr1305 G A 2: 111,873,439 R139W possibly damaging Het
Olfr851 T A 9: 19,496,877 L43Q probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Pik3c2g T A 6: 139,633,751 Y332N probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Rims2 A G 15: 39,462,560 S763G probably damaging Het
Sarm1 T A 11: 78,497,101 I120L probably benign Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Snx31 A G 15: 36,546,111 probably benign Het
Tmem150a C T 6: 72,357,052 S39F probably benign Het
Tsc2 T A 17: 24,597,264 H1605L probably damaging Het
Ugt1a10 TAAAAAAAAA TAAAAAAA 1: 88,215,928 probably benign Het
Vmn2r95 T C 17: 18,452,245 L820P probably damaging Het
Zfp36l3 T C X: 53,775,957 N97D possibly damaging Het
Other mutations in Cdk19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Cdk19 APN 10 40436165 missense probably benign 0.14
IGL00482:Cdk19 APN 10 40469648 missense possibly damaging 0.61
IGL03380:Cdk19 APN 10 40476912 missense probably benign 0.42
R0217:Cdk19 UTSW 10 40476258 splice site probably benign
R1639:Cdk19 UTSW 10 40476969 critical splice donor site probably null
R1899:Cdk19 UTSW 10 40479780 utr 3 prime probably benign
R2102:Cdk19 UTSW 10 40479730 utr 3 prime probably benign
R3828:Cdk19 UTSW 10 40475613 missense probably damaging 0.96
R4124:Cdk19 UTSW 10 40394395 missense probably benign 0.09
R4125:Cdk19 UTSW 10 40394395 missense probably benign 0.09
R4128:Cdk19 UTSW 10 40394395 missense probably benign 0.09
R4668:Cdk19 UTSW 10 40466710 missense probably damaging 0.98
R4750:Cdk19 UTSW 10 40476199 missense probably damaging 1.00
R4871:Cdk19 UTSW 10 40476236 missense probably benign 0.03
R4993:Cdk19 UTSW 10 40476218 missense possibly damaging 0.79
R5078:Cdk19 UTSW 10 40436154 missense probably damaging 1.00
R7130:Cdk19 UTSW 10 40479765 missense unknown
R7570:Cdk19 UTSW 10 40477958 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CCTGCAGGTAATTTGTTGCTC -3'
(R):5'- TTGCCTTCTACCATGAAACACC -3'

Sequencing Primer
(F):5'- CTGCAGGTAATTTGTTGCTCTTTTC -3'
(R):5'- CCACAGCAGCAAGGGCAG -3'
Posted On2015-07-21