Incidental Mutation 'R4474:Snx31'
ID330498
Institutional Source Beutler Lab
Gene Symbol Snx31
Ensembl Gene ENSMUSG00000013611
Gene Namesorting nexin 31
Synonyms4631426E05Rik
MMRRC Submission 041731-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4474 (G1)
Quality Score100
Status Validated
Chromosome15
Chromosomal Location36504062-36555573 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 36546111 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013755] [ENSMUST00000160936] [ENSMUST00000161202]
Predicted Effect probably benign
Transcript: ENSMUST00000013755
SMART Domains Protein: ENSMUSP00000013755
Gene: ENSMUSG00000013611

DomainStartEndE-ValueType
PX 1 105 5.44e-9 SMART
PDB:4GXB|A 112 382 1e-64 PDB
Blast:B41 115 324 1e-49 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160936
SMART Domains Protein: ENSMUSP00000124770
Gene: ENSMUSG00000013611

DomainStartEndE-ValueType
PDB:4GXB|A 71 134 7e-9 PDB
Blast:B41 75 134 1e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161202
SMART Domains Protein: ENSMUSP00000124063
Gene: ENSMUSG00000013611

DomainStartEndE-ValueType
PX 1 105 5.44e-9 SMART
PDB:4GXB|A 112 382 1e-64 PDB
Blast:B41 115 324 1e-49 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162888
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 95% (36/38)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,233,772 I397K possibly damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Cdh23 G T 10: 60,311,086 A2795D probably damaging Het
Cdk19 G A 10: 40,469,956 probably null Het
Cep104 T A 4: 153,989,236 M476K possibly damaging Het
Csf1 T C 3: 107,753,856 D115G probably damaging Het
Dclre1b C A 3: 103,807,243 probably benign Het
Fbp1 A G 13: 62,875,261 L74P probably damaging Het
Gm9573 G T 17: 35,620,604 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hydin G T 8: 110,563,865 V3319L probably benign Het
Kcna4 A G 2: 107,296,007 N362S probably benign Het
Kif13a C T 13: 46,814,155 probably null Het
Lingo2 T C 4: 35,708,810 E390G probably benign Het
Mdh1 T G 11: 21,566,624 D33A possibly damaging Het
Mov10 C T 3: 104,818,465 G21D probably damaging Het
Olfr1305 G A 2: 111,873,439 R139W possibly damaging Het
Olfr851 T A 9: 19,496,877 L43Q probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Pik3c2g T A 6: 139,633,751 Y332N probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Rims2 A G 15: 39,462,560 S763G probably damaging Het
Sarm1 T A 11: 78,497,101 I120L probably benign Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Tmem150a C T 6: 72,357,052 S39F probably benign Het
Tsc2 T A 17: 24,597,264 H1605L probably damaging Het
Ugt1a10 TAAAAAAAAA TAAAAAAA 1: 88,215,928 probably benign Het
Vmn2r95 T C 17: 18,452,245 L820P probably damaging Het
Zfp36l3 T C X: 53,775,957 N97D possibly damaging Het
Other mutations in Snx31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Snx31 APN 15 36545616 critical splice acceptor site probably null
IGL01627:Snx31 APN 15 36517672 missense probably damaging 1.00
IGL02514:Snx31 APN 15 36525582 missense probably damaging 1.00
IGL03069:Snx31 APN 15 36525603 nonsense probably null
IGL03182:Snx31 APN 15 36525687 missense probably benign 0.00
R0755:Snx31 UTSW 15 36534430 missense probably damaging 0.99
R1005:Snx31 UTSW 15 36517691 splice site probably benign
R1463:Snx31 UTSW 15 36539298 missense probably null 1.00
R1513:Snx31 UTSW 15 36545600 missense probably damaging 0.99
R2030:Snx31 UTSW 15 36525702 missense probably benign 0.31
R3404:Snx31 UTSW 15 36525653 missense probably benign 0.00
R3720:Snx31 UTSW 15 36523558 critical splice acceptor site probably null
R4152:Snx31 UTSW 15 36525639 missense probably benign
R4729:Snx31 UTSW 15 36523552 missense possibly damaging 0.92
R4998:Snx31 UTSW 15 36539367 missense probably damaging 0.96
R5010:Snx31 UTSW 15 36555324 missense probably damaging 1.00
R5375:Snx31 UTSW 15 36525584 missense probably damaging 0.99
R5893:Snx31 UTSW 15 36523455 missense probably damaging 0.98
R5970:Snx31 UTSW 15 36523488 nonsense probably null
R6211:Snx31 UTSW 15 36546885 missense probably damaging 0.98
R7198:Snx31 UTSW 15 36555310 missense probably benign 0.04
R7293:Snx31 UTSW 15 36523450 missense probably damaging 0.97
R7329:Snx31 UTSW 15 36555476 missense probably benign 0.00
R7741:Snx31 UTSW 15 36523441 critical splice donor site probably null
R8057:Snx31 UTSW 15 36523460 missense probably damaging 0.98
R8791:Snx31 UTSW 15 36537532 missense probably benign 0.01
R8806:Snx31 UTSW 15 36537552 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTTCCCAAAGAACCAATTGAGTT -3'
(R):5'- GCTTTATAGCTTTATTGCAGCGTAA -3'

Sequencing Primer
(F):5'- TTCATCACATGGTAGGAGCTC -3'
(R):5'- AGTTCTGTTCACAGGTCAGCGAC -3'
Posted On2015-07-21