Incidental Mutation 'R4474:Parn'
ID330500
Institutional Source Beutler Lab
Gene Symbol Parn
Ensembl Gene ENSMUSG00000022685
Gene Namepoly(A)-specific ribonuclease (deadenylation nuclease)
SynonymsDAN, 1200003I18Rik
MMRRC Submission 041731-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R4474 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location13537960-13668170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13664685 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 100 (S100P)
Ref Sequence ENSEMBL: ENSMUSP00000055969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058884] [ENSMUST00000229042] [ENSMUST00000231003]
Predicted Effect probably benign
Transcript: ENSMUST00000058884
AA Change: S100P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055969
Gene: ENSMUSG00000022685
AA Change: S100P

DomainStartEndE-ValueType
Pfam:CAF1 3 383 2.7e-86 PFAM
Pfam:R3H 172 236 2.8e-13 PFAM
Pfam:RNA_bind 430 508 2.2e-37 PFAM
low complexity region 564 578 N/A INTRINSIC
low complexity region 591 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229526
Predicted Effect probably benign
Transcript: ENSMUST00000231003
AA Change: S100P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0754 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 3'-exoribonuclease, with similarity to the RNase D family of 3'-exonucleases. It prefers poly(A) as the substrate, hence, efficiently degrades poly(A) tails of mRNAs. Exonucleolytic degradation of the poly(A) tail is often the first step in the decay of eukaryotic mRNAs. This protein is also involved in silencing of certain maternal mRNAs during oocyte maturation and early embryonic development, as well as in nonsense-mediated decay (NMD) of mRNAs that contain premature stop codons. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,233,772 I397K possibly damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Cdh23 G T 10: 60,311,086 A2795D probably damaging Het
Cdk19 G A 10: 40,469,956 probably null Het
Cep104 T A 4: 153,989,236 M476K possibly damaging Het
Csf1 T C 3: 107,753,856 D115G probably damaging Het
Dclre1b C A 3: 103,807,243 probably benign Het
Fbp1 A G 13: 62,875,261 L74P probably damaging Het
Gm9573 G T 17: 35,620,604 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hydin G T 8: 110,563,865 V3319L probably benign Het
Kcna4 A G 2: 107,296,007 N362S probably benign Het
Kif13a C T 13: 46,814,155 probably null Het
Lingo2 T C 4: 35,708,810 E390G probably benign Het
Mdh1 T G 11: 21,566,624 D33A possibly damaging Het
Mov10 C T 3: 104,818,465 G21D probably damaging Het
Olfr1305 G A 2: 111,873,439 R139W possibly damaging Het
Olfr851 T A 9: 19,496,877 L43Q probably damaging Het
Pik3c2g T A 6: 139,633,751 Y332N probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Rims2 A G 15: 39,462,560 S763G probably damaging Het
Sarm1 T A 11: 78,497,101 I120L probably benign Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Snx31 A G 15: 36,546,111 probably benign Het
Tmem150a C T 6: 72,357,052 S39F probably benign Het
Tsc2 T A 17: 24,597,264 H1605L probably damaging Het
Ugt1a10 TAAAAAAAAA TAAAAAAA 1: 88,215,928 probably benign Het
Vmn2r95 T C 17: 18,452,245 L820P probably damaging Het
Zfp36l3 T C X: 53,775,957 N97D possibly damaging Het
Other mutations in Parn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Parn APN 16 13667603 missense probably benign
IGL02030:Parn APN 16 13664650 splice site probably null
IGL02179:Parn APN 16 13667592 missense probably benign 0.00
IGL02336:Parn APN 16 13566703 missense probably damaging 1.00
arlette UTSW 16 13606171 missense probably damaging 1.00
PIT4453001:Parn UTSW 16 13607281 missense probably benign 0.00
PIT4651001:Parn UTSW 16 13631567 missense probably benign 0.25
R0388:Parn UTSW 16 13654476 missense possibly damaging 0.72
R0485:Parn UTSW 16 13654435 splice site probably benign
R0625:Parn UTSW 16 13640294 missense probably benign 0.02
R1104:Parn UTSW 16 13667585 missense probably damaging 0.99
R1299:Parn UTSW 16 13664729 missense probably benign 0.10
R1356:Parn UTSW 16 13650674 nonsense probably null
R2067:Parn UTSW 16 13603069 missense probably damaging 1.00
R2111:Parn UTSW 16 13603069 missense probably damaging 1.00
R2397:Parn UTSW 16 13566654 missense probably benign
R4473:Parn UTSW 16 13664685 missense probably benign 0.00
R4475:Parn UTSW 16 13664685 missense probably benign 0.00
R4476:Parn UTSW 16 13664685 missense probably benign 0.00
R4665:Parn UTSW 16 13541103 missense probably benign 0.19
R4795:Parn UTSW 16 13606202 missense probably benign 0.06
R5122:Parn UTSW 16 13654447 critical splice donor site probably null
R5226:Parn UTSW 16 13625552 missense probably benign
R5355:Parn UTSW 16 13668022 missense possibly damaging 0.92
R5570:Parn UTSW 16 13665930 missense probably damaging 0.98
R5979:Parn UTSW 16 13606171 missense probably damaging 1.00
R6009:Parn UTSW 16 13667564 missense probably damaging 1.00
R6173:Parn UTSW 16 13651811 missense possibly damaging 0.82
R6493:Parn UTSW 16 13656925 missense probably damaging 1.00
R7055:Parn UTSW 16 13626134 missense possibly damaging 0.80
R7278:Parn UTSW 16 13626063 intron probably null
R7391:Parn UTSW 16 13668006 splice site probably null
R7706:Parn UTSW 16 13607253 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGAGATAATTTACCCAAAGCC -3'
(R):5'- TGAGAAACCTGGCTCTCCTG -3'

Sequencing Primer
(F):5'- GGGCATCATATAGTCCAGACTGC -3'
(R):5'- AGCATTCCATGGACTTTTTGCTG -3'
Posted On2015-07-21