Incidental Mutation 'R4474:Siah1b'
ID330506
Institutional Source Beutler Lab
Gene Symbol Siah1b
Ensembl Gene ENSMUSG00000040749
Gene Namesiah E3 ubiquitin protein ligase 1B
SynonymsSinh1b
MMRRC Submission 041731-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.855) question?
Stock #R4474 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location164070705-164076493 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 164071692 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 131 (P131S)
Ref Sequence ENSEMBL: ENSMUSP00000071592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037928] [ENSMUST00000071667] [ENSMUST00000134272]
Predicted Effect probably damaging
Transcript: ENSMUST00000037928
AA Change: P131S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043215
Gene: ENSMUSG00000040749
AA Change: P131S

DomainStartEndE-ValueType
RING 41 75 5.56e-1 SMART
Pfam:Sina 82 278 1.2e-84 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000071667
AA Change: P131S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071592
Gene: ENSMUSG00000040749
AA Change: P131S

DomainStartEndE-ValueType
RING 41 75 5.56e-1 SMART
Pfam:Sina 82 278 1.2e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134272
SMART Domains Protein: ENSMUSP00000114867
Gene: ENSMUSG00000040749

DomainStartEndE-ValueType
SCOP:d1jm7b_ 21 65 1e-7 SMART
Blast:DUF4205 21 66 3e-17 BLAST
Meta Mutation Damage Score 0.8481 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: This gene encodes a member of the seven in absentia homolog (Siah) family of E3 ubiquitin ligase enzymes that catalyze the transfer of ubiquitin to substrate proteins. The encoded protein targets Pard3A (partitioning defective 3A) protein for proteasome-mediated degradation during the exit of cerebellar granule neurons from their germinal zone niche. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Primary mouse embryonic fibroblasts hemizygous for a targeted allele show no apparent alterations in Trp53-mediated responses or mitotic progression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,233,772 I397K possibly damaging Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Cdh23 G T 10: 60,311,086 A2795D probably damaging Het
Cdk19 G A 10: 40,469,956 probably null Het
Cep104 T A 4: 153,989,236 M476K possibly damaging Het
Csf1 T C 3: 107,753,856 D115G probably damaging Het
Dclre1b C A 3: 103,807,243 probably benign Het
Fbp1 A G 13: 62,875,261 L74P probably damaging Het
Gm9573 G T 17: 35,620,604 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hydin G T 8: 110,563,865 V3319L probably benign Het
Kcna4 A G 2: 107,296,007 N362S probably benign Het
Kif13a C T 13: 46,814,155 probably null Het
Lingo2 T C 4: 35,708,810 E390G probably benign Het
Mdh1 T G 11: 21,566,624 D33A possibly damaging Het
Mov10 C T 3: 104,818,465 G21D probably damaging Het
Olfr1305 G A 2: 111,873,439 R139W possibly damaging Het
Olfr851 T A 9: 19,496,877 L43Q probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Pik3c2g T A 6: 139,633,751 Y332N probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Rims2 A G 15: 39,462,560 S763G probably damaging Het
Sarm1 T A 11: 78,497,101 I120L probably benign Het
Snx31 A G 15: 36,546,111 probably benign Het
Tmem150a C T 6: 72,357,052 S39F probably benign Het
Tsc2 T A 17: 24,597,264 H1605L probably damaging Het
Ugt1a10 TAAAAAAAAA TAAAAAAA 1: 88,215,928 probably benign Het
Vmn2r95 T C 17: 18,452,245 L820P probably damaging Het
Zfp36l3 T C X: 53,775,957 N97D possibly damaging Het
Other mutations in Siah1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4435:Siah1b UTSW X 164071692 missense probably damaging 1.00
R4436:Siah1b UTSW X 164071692 missense probably damaging 1.00
R4437:Siah1b UTSW X 164071692 missense probably damaging 1.00
R4438:Siah1b UTSW X 164071692 missense probably damaging 1.00
R4473:Siah1b UTSW X 164071692 missense probably damaging 1.00
R4475:Siah1b UTSW X 164071692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGTTTCTCCAAGACTAACATG -3'
(R):5'- GTTTGTAGCAACTGTCGCCC -3'

Sequencing Primer
(F):5'- TGTTTCTCCAAGACTAACATGAAATG -3'
(R):5'- GTCGCCCCAAACTTACATGTTG -3'
Posted On2015-07-21