Incidental Mutation 'R4475:Oprk1'
ID330507
Institutional Source Beutler Lab
Gene Symbol Oprk1
Ensembl Gene ENSMUSG00000025905
Gene Nameopioid receptor, kappa 1
SynonymsR21, KOR-1, Oprk2
MMRRC Submission 041732-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R4475 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location5588466-5606131 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 5602601 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 320 (Y320*)
Ref Sequence ENSEMBL: ENSMUSP00000125105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027038] [ENSMUST00000160339] [ENSMUST00000160777]
Predicted Effect probably null
Transcript: ENSMUST00000027038
AA Change: Y320*
SMART Domains Protein: ENSMUSP00000027038
Gene: ENSMUSG00000025905
AA Change: Y320*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 67 280 4.8e-8 PFAM
Pfam:7TM_GPCR_Srsx 70 345 5.4e-14 PFAM
Pfam:7tm_1 76 330 2.6e-67 PFAM
Pfam:7TM_GPCR_Srv 79 345 6.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159083
Predicted Effect probably null
Transcript: ENSMUST00000160339
AA Change: Y320*
SMART Domains Protein: ENSMUSP00000124030
Gene: ENSMUSG00000025905
AA Change: Y320*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 67 284 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 70 345 5.4e-14 PFAM
Pfam:7tm_1 76 330 2.6e-60 PFAM
Pfam:7TM_GPCR_Srv 78 345 5.2e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000160777
AA Change: Y320*
SMART Domains Protein: ENSMUSP00000125105
Gene: ENSMUSG00000025905
AA Change: Y320*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 67 280 4.8e-8 PFAM
Pfam:7TM_GPCR_Srsx 70 345 5.4e-14 PFAM
Pfam:7tm_1 76 330 2.6e-67 PFAM
Pfam:7TM_GPCR_Srv 79 345 6.8e-9 PFAM
Meta Mutation Damage Score 0.9701 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: This gene encodes an opioid receptor, which is a member of the 7 transmembrane-spanning G protein-coupled receptor family. It functions as a receptor for endogenous ligands, as well as a receptor for various synthetic opioids. Ligand binding results in inhibition of adenylate cyclase activity and neurotransmitter release. This opioid receptor plays a role in the perception of pain and mediating the hypolocomotor, analgesic and aversive actions of synthetic opioids. Variations in this gene have also been associated with alcohol dependence and opiate addiction. Alternatively spliced transcript variants have been found for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired response to morphine and an opioid agonist, abnormal pain threshold, and increased litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,040,395 T904A probably damaging Het
A630010A05Rik T A 16: 14,589,363 I52N possibly damaging Het
Adgra3 A T 5: 50,001,898 Y337N probably damaging Het
Aga T C 8: 53,511,836 L11P probably damaging Het
Akap6 T C 12: 53,141,643 F1947L probably benign Het
Atp6v1c1 T C 15: 38,677,573 I114T probably benign Het
Dbh T A 2: 27,180,972 probably null Het
Dgkh T C 14: 78,589,878 D858G possibly damaging Het
Dlx5 T C 6: 6,881,663 Y75C probably damaging Het
Dnah8 T C 17: 30,656,985 F529L probably benign Het
Epg5 A C 18: 77,948,508 D140A probably benign Het
Esr2 C T 12: 76,133,942 D402N probably benign Het
Hells A G 19: 38,945,529 T265A probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspa8 T A 9: 40,804,146 probably benign Het
Ighm A G 12: 113,420,893 probably benign Het
Nedd4 C T 9: 72,671,239 R78* probably null Het
Nrxn1 G T 17: 90,701,982 N388K probably damaging Het
Olfr1412 T C 1: 92,588,579 V83A probably benign Het
Olfr418 T C 1: 173,270,913 V246A probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Piezo2 A G 18: 63,102,099 L809P probably damaging Het
Plek C T 11: 16,985,528 probably null Het
Prg4 T C 1: 150,454,859 probably benign Het
Rrs1 T C 1: 9,545,585 L21P probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Sim2 T C 16: 94,125,791 S625P probably benign Het
Smpd5 T C 15: 76,294,726 L98P probably damaging Het
Srpr A G 9: 35,212,859 K34E possibly damaging Het
Tbc1d2 A G 4: 46,609,080 V719A possibly damaging Het
Tmem52b C T 6: 129,514,256 H37Y probably benign Het
Tnip1 A G 11: 54,939,596 probably null Het
Trim3 A G 7: 105,617,802 Y457H probably damaging Het
Usp34 T C 11: 23,457,975 I2600T possibly damaging Het
Vmn2r-ps159 T G 4: 156,338,790 noncoding transcript Het
Zfp365 C A 10: 67,888,920 K379N possibly damaging Het
Other mutations in Oprk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Oprk1 APN 1 5598905 missense probably damaging 0.99
IGL02049:Oprk1 APN 1 5598844 missense probably damaging 1.00
IGL02076:Oprk1 APN 1 5602289 missense probably damaging 1.00
IGL02265:Oprk1 APN 1 5602648 missense probably damaging 1.00
IGL02294:Oprk1 APN 1 5602387 missense probably damaging 1.00
IGL02584:Oprk1 APN 1 5598604 missense probably damaging 1.00
IGL03164:Oprk1 APN 1 5598864 missense probably damaging 1.00
R0295:Oprk1 UTSW 1 5598850 missense possibly damaging 0.78
R1209:Oprk1 UTSW 1 5602261 missense probably benign 0.00
R1420:Oprk1 UTSW 1 5602321 missense probably damaging 1.00
R2994:Oprk1 UTSW 1 5602732 missense probably benign 0.00
R3876:Oprk1 UTSW 1 5602661 nonsense probably null
R4026:Oprk1 UTSW 1 5598685 missense probably benign 0.04
R4096:Oprk1 UTSW 1 5602811 utr 3 prime probably benign
R4097:Oprk1 UTSW 1 5602811 utr 3 prime probably benign
R5177:Oprk1 UTSW 1 5602674 missense probably damaging 1.00
R5223:Oprk1 UTSW 1 5589296 missense probably benign 0.30
R6397:Oprk1 UTSW 1 5598748 missense probably damaging 1.00
R6647:Oprk1 UTSW 1 5602284 missense probably damaging 1.00
R7169:Oprk1 UTSW 1 5589081 missense probably benign
R7170:Oprk1 UTSW 1 5602396 missense probably damaging 1.00
R8186:Oprk1 UTSW 1 5602317 missense probably benign 0.16
Z1176:Oprk1 UTSW 1 5602702 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAAGGACCGAAATCTCCGC -3'
(R):5'- GAACTCTTCTCTACCTGGAGAAC -3'

Sequencing Primer
(F):5'- GCCGCATCACCAAGCTG -3'
(R):5'- GACATTTCCACGACTAGTCATACTGG -3'
Posted On2015-07-21