Incidental Mutation 'R4475:Tbc1d2'
ID330515
Institutional Source Beutler Lab
Gene Symbol Tbc1d2
Ensembl Gene ENSMUSG00000039813
Gene NameTBC1 domain family, member 2
SynonymsPARIS-1, A630005A06Rik, LOC381605, PARIS1
MMRRC Submission 041732-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R4475 (G1)
Quality Score89
Status Validated
Chromosome4
Chromosomal Location46604390-46650209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46609080 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 719 (V719A)
Ref Sequence ENSEMBL: ENSMUSP00000081670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084621]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084621
AA Change: V719A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081670
Gene: ENSMUSG00000039813
AA Change: V719A

DomainStartEndE-ValueType
PH 44 143 1.94e-11 SMART
low complexity region 147 159 N/A INTRINSIC
low complexity region 165 180 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
coiled coil region 302 333 N/A INTRINSIC
coiled coil region 362 394 N/A INTRINSIC
low complexity region 398 410 N/A INTRINSIC
Blast:TBC 454 491 3e-14 BLAST
low complexity region 526 539 N/A INTRINSIC
Blast:TBC 557 591 3e-10 BLAST
TBC 616 834 1.63e-60 SMART
coiled coil region 869 906 N/A INTRINSIC
Meta Mutation Damage Score 0.6379 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,040,395 T904A probably damaging Het
A630010A05Rik T A 16: 14,589,363 I52N possibly damaging Het
Adgra3 A T 5: 50,001,898 Y337N probably damaging Het
Aga T C 8: 53,511,836 L11P probably damaging Het
Akap6 T C 12: 53,141,643 F1947L probably benign Het
Atp6v1c1 T C 15: 38,677,573 I114T probably benign Het
Dbh T A 2: 27,180,972 probably null Het
Dgkh T C 14: 78,589,878 D858G possibly damaging Het
Dlx5 T C 6: 6,881,663 Y75C probably damaging Het
Dnah8 T C 17: 30,656,985 F529L probably benign Het
Epg5 A C 18: 77,948,508 D140A probably benign Het
Esr2 C T 12: 76,133,942 D402N probably benign Het
Hells A G 19: 38,945,529 T265A probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspa8 T A 9: 40,804,146 probably benign Het
Ighm A G 12: 113,420,893 probably benign Het
Nedd4 C T 9: 72,671,239 R78* probably null Het
Nrxn1 G T 17: 90,701,982 N388K probably damaging Het
Olfr1412 T C 1: 92,588,579 V83A probably benign Het
Olfr418 T C 1: 173,270,913 V246A probably damaging Het
Oprk1 T A 1: 5,602,601 Y320* probably null Het
Parn A G 16: 13,664,685 S100P probably benign Het
Piezo2 A G 18: 63,102,099 L809P probably damaging Het
Plek C T 11: 16,985,528 probably null Het
Prg4 T C 1: 150,454,859 probably benign Het
Rrs1 T C 1: 9,545,585 L21P probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Sim2 T C 16: 94,125,791 S625P probably benign Het
Smpd5 T C 15: 76,294,726 L98P probably damaging Het
Srpr A G 9: 35,212,859 K34E possibly damaging Het
Tmem52b C T 6: 129,514,256 H37Y probably benign Het
Tnip1 A G 11: 54,939,596 probably null Het
Trim3 A G 7: 105,617,802 Y457H probably damaging Het
Usp34 T C 11: 23,457,975 I2600T possibly damaging Het
Vmn2r-ps159 T G 4: 156,338,790 noncoding transcript Het
Zfp365 C A 10: 67,888,920 K379N possibly damaging Het
Other mutations in Tbc1d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Tbc1d2 APN 4 46649745 missense probably benign 0.04
IGL01748:Tbc1d2 APN 4 46616306 missense probably damaging 0.99
IGL01863:Tbc1d2 APN 4 46607064 missense possibly damaging 0.66
IGL02014:Tbc1d2 APN 4 46649778 missense possibly damaging 0.83
IGL02025:Tbc1d2 APN 4 46620713 missense probably damaging 1.00
IGL02551:Tbc1d2 APN 4 46649916 missense probably benign
IGL02571:Tbc1d2 APN 4 46628370 missense probably benign 0.00
IGL03149:Tbc1d2 APN 4 46637619 missense probably benign 0.31
R0347:Tbc1d2 UTSW 4 46620574 missense possibly damaging 0.82
R0374:Tbc1d2 UTSW 4 46649913 missense possibly damaging 0.95
R0522:Tbc1d2 UTSW 4 46649806 missense probably damaging 1.00
R0883:Tbc1d2 UTSW 4 46609003 nonsense probably null
R1227:Tbc1d2 UTSW 4 46620629 missense probably benign 0.00
R1464:Tbc1d2 UTSW 4 46606491 missense possibly damaging 0.51
R1464:Tbc1d2 UTSW 4 46606491 missense possibly damaging 0.51
R1658:Tbc1d2 UTSW 4 46614207 missense probably damaging 1.00
R1959:Tbc1d2 UTSW 4 46606419 missense probably benign 0.44
R2108:Tbc1d2 UTSW 4 46637652 missense possibly damaging 0.62
R3864:Tbc1d2 UTSW 4 46620484 missense probably benign 0.01
R5112:Tbc1d2 UTSW 4 46606503 missense probably damaging 1.00
R5127:Tbc1d2 UTSW 4 46633639 intron probably benign
R5215:Tbc1d2 UTSW 4 46614006 missense probably benign 0.42
R5475:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5550:Tbc1d2 UTSW 4 46646138 missense probably benign 0.00
R5558:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5564:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5599:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5600:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5699:Tbc1d2 UTSW 4 46616298 missense probably benign 0.31
R5866:Tbc1d2 UTSW 4 46637715 missense possibly damaging 0.80
R5909:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5911:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R5980:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6194:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6195:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6209:Tbc1d2 UTSW 4 46614068 missense probably damaging 1.00
R6211:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6232:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6242:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6261:Tbc1d2 UTSW 4 46637692 missense possibly damaging 0.47
R6273:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6274:Tbc1d2 UTSW 4 46629912 missense probably benign 0.01
R6285:Tbc1d2 UTSW 4 46615045 missense possibly damaging 0.49
R6333:Tbc1d2 UTSW 4 46620736 missense possibly damaging 0.64
R6369:Tbc1d2 UTSW 4 46614420 missense probably benign 0.41
R6912:Tbc1d2 UTSW 4 46649712 missense probably damaging 1.00
R7428:Tbc1d2 UTSW 4 46649965 missense probably benign 0.02
R7824:Tbc1d2 UTSW 4 46637746 splice site probably null
R8069:Tbc1d2 UTSW 4 46649737 missense possibly damaging 0.81
X0023:Tbc1d2 UTSW 4 46615037 missense probably benign 0.00
X0063:Tbc1d2 UTSW 4 46606492 missense probably damaging 1.00
Z1177:Tbc1d2 UTSW 4 46650016 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGGCCACTGTTGTGTTGG -3'
(R):5'- GTGAGCATCCTCCAAACCTCTC -3'

Sequencing Primer
(F):5'- AGAGTCCCAGGATCTGCTG -3'
(R):5'- AAACCTCTCACCCCGGG -3'
Posted On2015-07-21