Incidental Mutation 'R4475:Aga'
ID330519
Institutional Source Beutler Lab
Gene Symbol Aga
Ensembl Gene ENSMUSG00000031521
Gene Nameaspartylglucosaminidase
Synonyms
MMRRC Submission 041732-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4475 (G1)
Quality Score194
Status Validated
Chromosome8
Chromosomal Location53511727-53523421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53511836 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 11 (L11P)
Ref Sequence ENSEMBL: ENSMUSP00000148133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033920] [ENSMUST00000209811] [ENSMUST00000211424]
Predicted Effect probably damaging
Transcript: ENSMUST00000033920
AA Change: L11P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033920
Gene: ENSMUSG00000031521
AA Change: L11P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Asparaginase_2 32 333 2.5e-86 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209811
AA Change: L11P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000211424
AA Change: L11P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.7372 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: This gene encodes an amidase enzyme that participates in the breakdown of glycoproteins in the cell. The encoded protein undergoes proteolytic processing to generate a mature enzyme. Mice lacking the encoded protein exhibit accumulation of aspartylglucosamine along with lysosomal vacuolization, axonal swelling in the gracile nucleus and impaired neuromotor coordination. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate this gene die prematurely and share most of the clinical, biochemical and histopathological characteristics of human aspartylglycosaminuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,040,395 T904A probably damaging Het
A630010A05Rik T A 16: 14,589,363 I52N possibly damaging Het
Adgra3 A T 5: 50,001,898 Y337N probably damaging Het
Akap6 T C 12: 53,141,643 F1947L probably benign Het
Atp6v1c1 T C 15: 38,677,573 I114T probably benign Het
Dbh T A 2: 27,180,972 probably null Het
Dgkh T C 14: 78,589,878 D858G possibly damaging Het
Dlx5 T C 6: 6,881,663 Y75C probably damaging Het
Dnah8 T C 17: 30,656,985 F529L probably benign Het
Epg5 A C 18: 77,948,508 D140A probably benign Het
Esr2 C T 12: 76,133,942 D402N probably benign Het
Hells A G 19: 38,945,529 T265A probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspa8 T A 9: 40,804,146 probably benign Het
Ighm A G 12: 113,420,893 probably benign Het
Nedd4 C T 9: 72,671,239 R78* probably null Het
Nrxn1 G T 17: 90,701,982 N388K probably damaging Het
Olfr1412 T C 1: 92,588,579 V83A probably benign Het
Olfr418 T C 1: 173,270,913 V246A probably damaging Het
Oprk1 T A 1: 5,602,601 Y320* probably null Het
Parn A G 16: 13,664,685 S100P probably benign Het
Piezo2 A G 18: 63,102,099 L809P probably damaging Het
Plek C T 11: 16,985,528 probably null Het
Prg4 T C 1: 150,454,859 probably benign Het
Rrs1 T C 1: 9,545,585 L21P probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Sim2 T C 16: 94,125,791 S625P probably benign Het
Smpd5 T C 15: 76,294,726 L98P probably damaging Het
Srpr A G 9: 35,212,859 K34E possibly damaging Het
Tbc1d2 A G 4: 46,609,080 V719A possibly damaging Het
Tmem52b C T 6: 129,514,256 H37Y probably benign Het
Tnip1 A G 11: 54,939,596 probably null Het
Trim3 A G 7: 105,617,802 Y457H probably damaging Het
Usp34 T C 11: 23,457,975 I2600T possibly damaging Het
Vmn2r-ps159 T G 4: 156,338,790 noncoding transcript Het
Zfp365 C A 10: 67,888,920 K379N possibly damaging Het
Other mutations in Aga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Aga APN 8 53518921 missense probably benign
IGL02581:Aga APN 8 53521044 splice site probably benign
IGL02617:Aga APN 8 53520313 missense possibly damaging 0.66
IGL03008:Aga APN 8 53511826 missense probably benign
R2099:Aga UTSW 8 53521131 nonsense probably null
R3747:Aga UTSW 8 53517821 missense probably benign
R4018:Aga UTSW 8 53523191 missense probably benign 0.00
R4247:Aga UTSW 8 53511830 missense possibly damaging 0.72
R4399:Aga UTSW 8 53511826 missense probably benign
R4421:Aga UTSW 8 53511826 missense probably benign
R5235:Aga UTSW 8 53514326 missense probably damaging 1.00
R5640:Aga UTSW 8 53511884 missense probably damaging 1.00
R7748:Aga UTSW 8 53511805 start codon destroyed possibly damaging 0.79
X0027:Aga UTSW 8 53521156 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGAAGGCCTCGTTGTCTCG -3'
(R):5'- TCCTAAAATGCAGCAGGGGC -3'

Sequencing Primer
(F):5'- TCGCGAGAGTTGAGGAAGTTG -3'
(R):5'- TCTGGTGTAAAGTCAGAGATGC -3'
Posted On2015-07-21