Incidental Mutation 'R4475:Ighm'
ID330529
Institutional Source Beutler Lab
Gene Symbol Ighm
Ensembl Gene ENSMUSG00000076617
Gene Nameimmunoglobulin heavy constant mu
SynonymsmuH, IgM, Igh6, Igh-M, Ig mu
MMRRC Submission 041732-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R4475 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location113418558-113422730 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 113420893 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect unknown
Transcript: ENSMUST00000103426
AA Change: S447P
SMART Domains Protein: ENSMUSP00000100222
Gene: ENSMUSG00000076617
AA Change: S447P

DomainStartEndE-ValueType
IG_like 23 99 1.94e-2 SMART
IGc1 131 209 2.37e-14 SMART
IG_like 241 315 1.6e-2 SMART
IGc1 348 425 1.94e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175007
Predicted Effect probably benign
Transcript: ENSMUST00000177715
Predicted Effect probably benign
Transcript: ENSMUST00000192250
Predicted Effect probably benign
Transcript: ENSMUST00000194162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196624
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 97% (38/39)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,040,395 T904A probably damaging Het
A630010A05Rik T A 16: 14,589,363 I52N possibly damaging Het
Adgra3 A T 5: 50,001,898 Y337N probably damaging Het
Aga T C 8: 53,511,836 L11P probably damaging Het
Akap6 T C 12: 53,141,643 F1947L probably benign Het
Atp6v1c1 T C 15: 38,677,573 I114T probably benign Het
Dbh T A 2: 27,180,972 probably null Het
Dgkh T C 14: 78,589,878 D858G possibly damaging Het
Dlx5 T C 6: 6,881,663 Y75C probably damaging Het
Dnah8 T C 17: 30,656,985 F529L probably benign Het
Epg5 A C 18: 77,948,508 D140A probably benign Het
Esr2 C T 12: 76,133,942 D402N probably benign Het
Hells A G 19: 38,945,529 T265A probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspa8 T A 9: 40,804,146 probably benign Het
Nedd4 C T 9: 72,671,239 R78* probably null Het
Nrxn1 G T 17: 90,701,982 N388K probably damaging Het
Olfr1412 T C 1: 92,588,579 V83A probably benign Het
Olfr418 T C 1: 173,270,913 V246A probably damaging Het
Oprk1 T A 1: 5,602,601 Y320* probably null Het
Parn A G 16: 13,664,685 S100P probably benign Het
Piezo2 A G 18: 63,102,099 L809P probably damaging Het
Plek C T 11: 16,985,528 probably null Het
Prg4 T C 1: 150,454,859 probably benign Het
Rrs1 T C 1: 9,545,585 L21P probably damaging Het
Siah1b G A X: 164,071,692 P131S probably damaging Het
Sim2 T C 16: 94,125,791 S625P probably benign Het
Smpd5 T C 15: 76,294,726 L98P probably damaging Het
Srpr A G 9: 35,212,859 K34E possibly damaging Het
Tbc1d2 A G 4: 46,609,080 V719A possibly damaging Het
Tmem52b C T 6: 129,514,256 H37Y probably benign Het
Tnip1 A G 11: 54,939,596 probably null Het
Trim3 A G 7: 105,617,802 Y457H probably damaging Het
Usp34 T C 11: 23,457,975 I2600T possibly damaging Het
Vmn2r-ps159 T G 4: 156,338,790 noncoding transcript Het
Zfp365 C A 10: 67,888,920 K379N possibly damaging Het
Other mutations in Ighm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Ighm APN 12 113421234 unclassified probably benign
IGL01775:Ighm APN 12 113422467 missense unknown
IGL02069:Ighm APN 12 113421148 unclassified probably benign
IGL03124:Ighm APN 12 113421638 missense unknown
manifest UTSW 12 113421253 nonsense probably null
R3055:Ighm UTSW 12 113418976 unclassified probably benign
R3056:Ighm UTSW 12 113418976 unclassified probably benign
R4164:Ighm UTSW 12 113422295 missense unknown
R4871:Ighm UTSW 12 113421621 missense unknown
R5542:Ighm UTSW 12 113418981 unclassified probably benign
R5738:Ighm UTSW 12 113421495 missense unknown
R5856:Ighm UTSW 12 113421602 missense unknown
R5946:Ighm UTSW 12 113422709 missense unknown
R6267:Ighm UTSW 12 113421567 missense unknown
R6296:Ighm UTSW 12 113421567 missense unknown
R7409:Ighm UTSW 12 113422232 missense
R7492:Ighm UTSW 12 113422673 missense
R7898:Ighm UTSW 12 113421253 nonsense probably null
R8089:Ighm UTSW 12 113421234 unclassified probably benign
R8301:Ighm UTSW 12 113421545 missense
R8444:Ighm UTSW 12 113421193 missense
Predicted Primers PCR Primer
(F):5'- CAAGTATGCAGGGTGTGTGC -3'
(R):5'- CAGGCTTCTACTTTACCCACAG -3'

Sequencing Primer
(F):5'- TCTCAGCAGGCATGAGCATTG -3'
(R):5'- CAGCATCCTGACTGTGACAGAG -3'
Posted On2015-07-21