Incidental Mutation 'R0052:Ginm1'
ID33055
Institutional Source Beutler Lab
Gene Symbol Ginm1
Ensembl Gene ENSMUSG00000040006
Gene Nameglycoprotein integral membrane 1
SynonymsBC013529
MMRRC Submission 038346-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0052 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location7767947-7792824 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7779306 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 57 (E57D)
Ref Sequence ENSEMBL: ENSMUSP00000119129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039763] [ENSMUST00000124838]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039763
AA Change: E57D

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040961
Gene: ENSMUSG00000040006
AA Change: E57D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 260 282 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124447
Predicted Effect possibly damaging
Transcript: ENSMUST00000124838
AA Change: E57D

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119129
Gene: ENSMUSG00000040006
AA Change: E57D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 261 283 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180853
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 97% (65/67)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 T C 19: 23,915,951 S438P possibly damaging Het
Atp2a1 A G 7: 126,457,897 probably benign Het
Axin2 T C 11: 108,949,270 Y735H probably damaging Het
Bicd2 T A 13: 49,375,314 L184Q probably damaging Het
Bub1 G A 2: 127,809,039 T618I probably benign Het
Catsperg2 A G 7: 29,725,020 probably benign Het
Ccdc73 T A 2: 104,929,570 probably benign Het
Crybg3 A T 16: 59,565,656 probably benign Het
Dsp A G 13: 38,197,364 D2096G possibly damaging Het
Eef2 C CN 10: 81,178,768 probably null Het
Elp3 A G 14: 65,531,526 *548Q probably null Het
Eno4 A G 19: 58,968,553 D357G probably damaging Het
Fam214a A G 9: 75,018,983 probably benign Het
Fcrls A T 3: 87,256,778 I348N possibly damaging Het
Fgl2 A T 5: 21,375,349 S230C probably damaging Het
Gtf3c1 A T 7: 125,667,971 probably null Het
Herc1 G T 9: 66,400,156 G1044V probably damaging Het
Hmcn1 G A 1: 150,677,406 T2511M probably damaging Het
Iba57 C T 11: 59,158,901 A207T probably benign Het
Itga9 T A 9: 118,636,549 I157N probably damaging Het
Kalrn A G 16: 34,357,171 L208P probably damaging Het
Kcnj10 A G 1: 172,368,924 T2A probably benign Het
Kdm1b T A 13: 47,064,117 C351S probably damaging Het
Kif21a T C 15: 90,970,857 E700G probably damaging Het
Mmd C T 11: 90,259,998 probably benign Het
Mocs3 C T 2: 168,231,682 P350S probably benign Het
Morn3 T C 5: 123,046,663 Y38C probably damaging Het
Nacc1 A T 8: 84,676,225 V313D probably benign Het
Nbeal1 T A 1: 60,228,612 probably benign Het
Neb T C 2: 52,273,980 K1989E possibly damaging Het
Nlrp3 C T 11: 59,565,128 R917* probably null Het
Nlrp4b T A 7: 10,725,962 Y463* probably null Het
Perm1 A T 4: 156,218,115 D372V probably damaging Het
Phf3 T C 1: 30,808,767 T1232A probably damaging Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Pld4 T A 12: 112,767,857 F386I probably benign Het
Prex2 T A 1: 11,160,156 L802Q probably damaging Het
Psd3 A G 8: 67,882,979 probably null Het
Ralgds T A 2: 28,544,388 probably null Het
Rmdn2 A G 17: 79,650,331 E16G probably damaging Het
Rnf111 A T 9: 70,476,389 S87R probably benign Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc9c1 A G 16: 45,606,856 probably benign Het
Slco3a1 A T 7: 74,504,326 I166N probably benign Het
Snx5 A T 2: 144,259,192 probably null Het
Srgap1 T C 10: 121,800,827 D741G possibly damaging Het
St8sia2 G T 7: 73,943,290 Y339* probably null Het
St8sia2 A T 7: 73,971,952 W86R probably damaging Het
Stk33 A G 7: 109,279,669 L491P possibly damaging Het
Sult2a7 T C 7: 14,465,208 Y298C probably damaging Het
Tdo2 T A 3: 81,967,025 N210I probably benign Het
Thada A T 17: 84,455,158 N104K probably damaging Het
Timm8b A T 9: 50,605,030 D61V possibly damaging Het
Tshz1 G A 18: 84,014,945 T446I possibly damaging Het
Ubap2l T C 3: 90,038,928 N123S possibly damaging Het
Vmn1r48 T C 6: 90,036,264 E193G possibly damaging Het
Vmn1r69 C T 7: 10,580,400 V135I probably benign Het
Vmn2r103 G T 17: 19,811,641 G559V probably benign Het
Vmn2r26 T A 6: 124,062,033 *856R probably null Het
Vmn2r88 A G 14: 51,418,700 I798V possibly damaging Het
Vsir C T 10: 60,358,082 A108V probably benign Het
Zfp14 G T 7: 30,038,328 Q411K probably damaging Het
Zfp236 A T 18: 82,639,332 M762K probably damaging Het
Zfp462 G A 4: 55,011,762 G1243S probably benign Het
Other mutations in Ginm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Ginm1 APN 10 7792696 unclassified probably benign
IGL02474:Ginm1 APN 10 7777768 splice site probably benign
IGL02606:Ginm1 APN 10 7770399 missense probably damaging 0.98
R0010:Ginm1 UTSW 10 7775374 splice site probably benign
R0010:Ginm1 UTSW 10 7775374 splice site probably benign
R0052:Ginm1 UTSW 10 7779306 missense possibly damaging 0.92
R1901:Ginm1 UTSW 10 7775216 critical splice donor site probably null
R2106:Ginm1 UTSW 10 7775326 missense probably damaging 1.00
R5374:Ginm1 UTSW 10 7779314 missense probably damaging 0.99
R5929:Ginm1 UTSW 10 7774050 missense probably benign 0.16
R6062:Ginm1 UTSW 10 7775333 missense probably benign 0.00
R6102:Ginm1 UTSW 10 7768496 missense probably benign 0.00
R6792:Ginm1 UTSW 10 7773983 missense probably damaging 1.00
R7326:Ginm1 UTSW 10 7777850 nonsense probably null
R7417:Ginm1 UTSW 10 7774080 missense probably damaging 0.99
R7663:Ginm1 UTSW 10 7775362 missense possibly damaging 0.84
R7757:Ginm1 UTSW 10 7779355 missense probably damaging 1.00
R8237:Ginm1 UTSW 10 7792655 missense unknown
R8437:Ginm1 UTSW 10 7770366 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGCAGCCTGTCACTGGAGAATG -3'
(R):5'- GCCGCAATTTCTTCTGGGTAAAATAGC -3'

Sequencing Primer
(F):5'- ccactgagccatccttcc -3'
(R):5'- CTTCTGGGTAAAATAGCAACTGTGC -3'
Posted On2013-05-09