Mutagenetix > Incidental Mutations

Incidental Mutation 'R4476:Cracr2a'

330559

Institutional Source

Beutler Lab

Gene Symbol

Cracr2a

Ensembl Gene

ENSMUSG00000061414

Gene Name

calcium release activated channel regulator 2A

Synonyms

LOC243645, Efcab4b, LOC381812

MMRRC Submission

041733-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4476 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127561338-127674248 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 127629819 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 275 (N275K)

Ref Sequence

ENSEMBL: ENSMUSP00000071494 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071563] [ENSMUST00000212051]

AlphaFold

Q3UP38

Predicted Effect

probably benign
Transcript: ENSMUST00000071563
AA Change: N275K

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000071494
Gene: ENSMUSG00000061414
AA Change: N275K

Domain	Start	End	E-Value	Type
EFh	48	76	2.82e1	SMART
EFh	82	110	2.09e-4	SMART
coiled coil region	192	282	N/A	INTRINSIC
low complexity region	295	307	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201303

SMART Domains

Protein: ENSMUSP00000143930
Gene: ENSMUSG00000061414

Domain	Start	End	E-Value	Type
EFh	48	76	2.82e1	SMART
EFh	82	110	2.09e-4	SMART
coiled coil region	192	282	N/A	INTRINSIC
low complexity region	295	307	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000212051
AA Change: N275K

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 94.2%

Validation Efficiency

98% (41/42)

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acin1	T	C	14: 54,645,330	R275G	probably damaging	Het
Actc1	T	C	2: 114,049,226	T251A	probably benign	Het
Alpk1	T	C	3: 127,680,018	T779A	probably damaging	Het
Arsb	C	T	13: 93,807,595	R265C	probably damaging	Het
Cntn6	A	G	6: 104,772,561	E319G	probably damaging	Het
Crispld1	G	T	1: 17,747,510	W212C	probably damaging	Het
Exosc10	G	A	4: 148,565,324	D404N	probably damaging	Het
Gfpt2	T	C	11: 49,824,342	V388A	probably benign	Het
Gm14401	C	T	2: 177,086,777	R219*	probably null	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Itgb1bp1	T	C	12: 21,270,956	E178G	probably benign	Het
Kidins220	C	T	12: 25,011,001	S826L	probably damaging	Het
Krt90	T	C	15: 101,557,283	D301G	probably damaging	Het
Me3	T	A	7: 89,739,860	V124E	probably damaging	Het
Nedd4	C	T	9: 72,671,239	R78*	probably null	Het
Neto1	A	T	18: 86,404,673	D85V	probably damaging	Het
Olfr1288	T	A	2: 111,479,664	D293E	possibly damaging	Het
Olfr361	G	A	2: 37,085,061	S229L	probably damaging	Het
Olfr538	T	C	7: 140,574,929	Y259H	probably damaging	Het
Parn	A	G	16: 13,664,685	S100P	probably benign	Het
Pkd1	A	G	17: 24,576,526	E2331G	probably damaging	Het
Rab22a	C	T	2: 173,695,263	T85M	probably damaging	Het
Rab23	A	G	1: 33,724,892		probably benign	Het
Sim2	T	C	16: 94,125,791	S625P	probably benign	Het
Sox18	T	C	2: 181,670,876	K154R	probably damaging	Het
Tanc1	A	G	2: 59,841,996		probably null	Het
Ugt1a10	TAAAAAAAAA	TAAAAAAA	1: 88,215,928		probably benign	Het
Zfp667	A	G	7: 6,304,599	K89E	possibly damaging	Het

Other mutations in Cracr2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02136:Cracr2a	APN	6	127629930	intron	probably benign
PIT4812001:Cracr2a	UTSW	6	127625870	missense	probably damaging	1.00
R0111:Cracr2a	UTSW	6	127604061	missense	probably benign	0.00
R0180:Cracr2a	UTSW	6	127604074	critical splice donor site	probably null
R1612:Cracr2a	UTSW	6	127603929	nonsense	probably null
R1929:Cracr2a	UTSW	6	127607298	missense	probably damaging	1.00
R2055:Cracr2a	UTSW	6	127608601	nonsense	probably null
R2270:Cracr2a	UTSW	6	127607298	missense	probably damaging	1.00
R2272:Cracr2a	UTSW	6	127607298	missense	probably damaging	1.00
R2915:Cracr2a	UTSW	6	127611505	missense	probably damaging	0.98
R4600:Cracr2a	UTSW	6	127603888	missense	probably benign	0.00
R4767:Cracr2a	UTSW	6	127611507	missense	probably damaging	0.98
R5256:Cracr2a	UTSW	6	127604029	missense	probably damaging	1.00
R5657:Cracr2a	UTSW	6	127604007	missense	probably damaging	1.00
R5729:Cracr2a	UTSW	6	127607236	missense	possibly damaging	0.88
R6437:Cracr2a	UTSW	6	127631831	missense	probably damaging	0.96
R6572:Cracr2a	UTSW	6	127608752	splice site	probably null
R6851:Cracr2a	UTSW	6	127608716	missense	probably damaging	1.00
R7177:Cracr2a	UTSW	6	127608706	missense	probably benign	0.00
R7616:Cracr2a	UTSW	6	127608697	nonsense	probably null
R7809:Cracr2a	UTSW	6	127649962	missense	probably benign
R8030:Cracr2a	UTSW	6	127611423	missense	probably damaging	0.96
R8084:Cracr2a	UTSW	6	127639172	missense	probably benign	0.26
R8731:Cracr2a	UTSW	6	127625927	critical splice donor site	probably null
R8867:Cracr2a	UTSW	6	127629773	nonsense	probably null
Z1177:Cracr2a	UTSW	6	127607244	missense	probably benign	0.02
Z1177:Cracr2a	UTSW	6	127669063	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGGAATCGGTGGTCCAGC -3'
(R):5'- TGGCTCTAAATGGGGCCATC -3'

Sequencing Primer
(F):5'- CCAGCTGGTGAGGGAGTTC -3'
(R):5'- TGCACTATATCCACAGGGCTG -3'

Posted On

2015-07-21