Incidental Mutation 'R4476:Cracr2a'
ID 330559
Institutional Source Beutler Lab
Gene Symbol Cracr2a
Ensembl Gene ENSMUSG00000061414
Gene Name calcium release activated channel regulator 2A
Synonyms LOC243645, Efcab4b, LOC381812
MMRRC Submission 041733-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4476 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 127561338-127674248 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 127629819 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 275 (N275K)
Ref Sequence ENSEMBL: ENSMUSP00000071494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071563] [ENSMUST00000212051]
AlphaFold Q3UP38
Predicted Effect probably benign
Transcript: ENSMUST00000071563
AA Change: N275K

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000071494
Gene: ENSMUSG00000061414
AA Change: N275K

DomainStartEndE-ValueType
EFh 48 76 2.82e1 SMART
EFh 82 110 2.09e-4 SMART
coiled coil region 192 282 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201303
SMART Domains Protein: ENSMUSP00000143930
Gene: ENSMUSG00000061414

DomainStartEndE-ValueType
EFh 48 76 2.82e1 SMART
EFh 82 110 2.09e-4 SMART
coiled coil region 192 282 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212051
AA Change: N275K

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,645,330 R275G probably damaging Het
Actc1 T C 2: 114,049,226 T251A probably benign Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Arsb C T 13: 93,807,595 R265C probably damaging Het
Cntn6 A G 6: 104,772,561 E319G probably damaging Het
Crispld1 G T 1: 17,747,510 W212C probably damaging Het
Exosc10 G A 4: 148,565,324 D404N probably damaging Het
Gfpt2 T C 11: 49,824,342 V388A probably benign Het
Gm14401 C T 2: 177,086,777 R219* probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itgb1bp1 T C 12: 21,270,956 E178G probably benign Het
Kidins220 C T 12: 25,011,001 S826L probably damaging Het
Krt90 T C 15: 101,557,283 D301G probably damaging Het
Me3 T A 7: 89,739,860 V124E probably damaging Het
Nedd4 C T 9: 72,671,239 R78* probably null Het
Neto1 A T 18: 86,404,673 D85V probably damaging Het
Olfr1288 T A 2: 111,479,664 D293E possibly damaging Het
Olfr361 G A 2: 37,085,061 S229L probably damaging Het
Olfr538 T C 7: 140,574,929 Y259H probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Pkd1 A G 17: 24,576,526 E2331G probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Rab23 A G 1: 33,724,892 probably benign Het
Sim2 T C 16: 94,125,791 S625P probably benign Het
Sox18 T C 2: 181,670,876 K154R probably damaging Het
Tanc1 A G 2: 59,841,996 probably null Het
Ugt1a10 TAAAAAAAAA TAAAAAAA 1: 88,215,928 probably benign Het
Zfp667 A G 7: 6,304,599 K89E possibly damaging Het
Other mutations in Cracr2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:Cracr2a APN 6 127629930 intron probably benign
PIT4812001:Cracr2a UTSW 6 127625870 missense probably damaging 1.00
R0111:Cracr2a UTSW 6 127604061 missense probably benign 0.00
R0180:Cracr2a UTSW 6 127604074 critical splice donor site probably null
R1612:Cracr2a UTSW 6 127603929 nonsense probably null
R1929:Cracr2a UTSW 6 127607298 missense probably damaging 1.00
R2055:Cracr2a UTSW 6 127608601 nonsense probably null
R2270:Cracr2a UTSW 6 127607298 missense probably damaging 1.00
R2272:Cracr2a UTSW 6 127607298 missense probably damaging 1.00
R2915:Cracr2a UTSW 6 127611505 missense probably damaging 0.98
R4600:Cracr2a UTSW 6 127603888 missense probably benign 0.00
R4767:Cracr2a UTSW 6 127611507 missense probably damaging 0.98
R5256:Cracr2a UTSW 6 127604029 missense probably damaging 1.00
R5657:Cracr2a UTSW 6 127604007 missense probably damaging 1.00
R5729:Cracr2a UTSW 6 127607236 missense possibly damaging 0.88
R6437:Cracr2a UTSW 6 127631831 missense probably damaging 0.96
R6572:Cracr2a UTSW 6 127608752 splice site probably null
R6851:Cracr2a UTSW 6 127608716 missense probably damaging 1.00
R7177:Cracr2a UTSW 6 127608706 missense probably benign 0.00
R7616:Cracr2a UTSW 6 127608697 nonsense probably null
R7809:Cracr2a UTSW 6 127649962 missense probably benign
R8030:Cracr2a UTSW 6 127611423 missense probably damaging 0.96
R8084:Cracr2a UTSW 6 127639172 missense probably benign 0.26
R8731:Cracr2a UTSW 6 127625927 critical splice donor site probably null
R8867:Cracr2a UTSW 6 127629773 nonsense probably null
Z1177:Cracr2a UTSW 6 127607244 missense probably benign 0.02
Z1177:Cracr2a UTSW 6 127669063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGAATCGGTGGTCCAGC -3'
(R):5'- TGGCTCTAAATGGGGCCATC -3'

Sequencing Primer
(F):5'- CCAGCTGGTGAGGGAGTTC -3'
(R):5'- TGCACTATATCCACAGGGCTG -3'
Posted On 2015-07-21