Mutagenetix > Incidental Mutation

Incidental Mutation 'R4476:Nedd4'

330566

Institutional Source

Beutler Lab

Gene Symbol

Nedd4

Ensembl Gene

ENSMUSG00000032216

Gene Name

neural precursor cell expressed, developmentally down-regulated 4

Synonyms

Nedd4, Nedd4-1, Nedd4a

MMRRC Submission

041733-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4476 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72662346-72749852 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 72671239 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 78 (R78*)

Ref Sequence

ENSEMBL: ENSMUSP00000138983 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034740] [ENSMUST00000183375] [ENSMUST00000184333] [ENSMUST00000184450]

AlphaFold

P46935

Predicted Effect

probably null
Transcript: ENSMUST00000034740
AA Change: R78*

SMART Domains

Protein: ENSMUSP00000034740
Gene: ENSMUSG00000032216
AA Change: R78*

Domain	Start	End	E-Value	Type
C2	79	181	5.38e-21	SMART
WW	250	282	2.32e-13	SMART
low complexity region	283	293	N/A	INTRINSIC
WW	406	438	1.31e-12	SMART
WW	461	493	1.26e-14	SMART
HECTc	550	886	2.37e-194	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000183375
AA Change: R78*

SMART Domains

Protein: ENSMUSP00000138852
Gene: ENSMUSG00000032216
AA Change: R78*

Domain	Start	End	E-Value	Type
C2	79	163	1.12e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184180

Predicted Effect

probably benign
Transcript: ENSMUST00000184333

SMART Domains

Protein: ENSMUSP00000139190
Gene: ENSMUSG00000032216

Domain	Start	End	E-Value	Type
C2	4	71	3.38e-4	SMART
WW	140	172	2.32e-13	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000184450
AA Change: R78*

SMART Domains

Protein: ENSMUSP00000138983
Gene: ENSMUSG00000032216
AA Change: R78*

Domain	Start	End	E-Value	Type
C2	79	181	5.38e-21	SMART
WW	250	282	2.32e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184737

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 94.2%

Validation Efficiency

98% (41/42)

MGI Phenotype

PHENOTYPE: Homozygous mutation of this gene results in neonatal lethality and heterozygous mice have decreased body weights. Mice homozygous for a knockout allele exhibit impaired neurite development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acin1	T	C	14: 54,645,330	R275G	probably damaging	Het
Actc1	T	C	2: 114,049,226	T251A	probably benign	Het
Alpk1	T	C	3: 127,680,018	T779A	probably damaging	Het
Arsb	C	T	13: 93,807,595	R265C	probably damaging	Het
Cntn6	A	G	6: 104,772,561	E319G	probably damaging	Het
Cracr2a	T	A	6: 127,629,819	N275K	probably benign	Het
Crispld1	G	T	1: 17,747,510	W212C	probably damaging	Het
Exosc10	G	A	4: 148,565,324	D404N	probably damaging	Het
Gfpt2	T	C	11: 49,824,342	V388A	probably benign	Het
Gm14401	C	T	2: 177,086,777	R219*	probably null	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Itgb1bp1	T	C	12: 21,270,956	E178G	probably benign	Het
Kidins220	C	T	12: 25,011,001	S826L	probably damaging	Het
Krt90	T	C	15: 101,557,283	D301G	probably damaging	Het
Me3	T	A	7: 89,739,860	V124E	probably damaging	Het
Neto1	A	T	18: 86,404,673	D85V	probably damaging	Het
Olfr1288	T	A	2: 111,479,664	D293E	possibly damaging	Het
Olfr361	G	A	2: 37,085,061	S229L	probably damaging	Het
Olfr538	T	C	7: 140,574,929	Y259H	probably damaging	Het
Parn	A	G	16: 13,664,685	S100P	probably benign	Het
Pkd1	A	G	17: 24,576,526	E2331G	probably damaging	Het
Rab22a	C	T	2: 173,695,263	T85M	probably damaging	Het
Rab23	A	G	1: 33,724,892		probably benign	Het
Sim2	T	C	16: 94,125,791	S625P	probably benign	Het
Sox18	T	C	2: 181,670,876	K154R	probably damaging	Het
Tanc1	A	G	2: 59,841,996		probably null	Het
Ugt1a10	TAAAAAAAAA	TAAAAAAA	1: 88,215,928		probably benign	Het
Zfp667	A	G	7: 6,304,599	K89E	possibly damaging	Het

Other mutations in Nedd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Nedd4	APN	9	72735089	missense	probably damaging	1.00
IGL00573:Nedd4	APN	9	72686056	splice site	probably null
IGL01973:Nedd4	APN	9	72736934	missense	possibly damaging	0.81
IGL02177:Nedd4	APN	9	72747157	missense	probably damaging	1.00
IGL03082:Nedd4	APN	9	72677394	critical splice donor site	probably null
Evaporation	UTSW	9	72686095	missense	probably damaging	1.00
Reduction	UTSW	9	72731271	missense	possibly damaging	0.49
Snookie	UTSW	9	72725064	missense	probably benign	0.04
Sublimation	UTSW	9	72677379	nonsense	probably null
R0194:Nedd4	UTSW	9	72670053	missense	possibly damaging	0.72
R0714:Nedd4	UTSW	9	72731446	splice site	probably benign
R1331:Nedd4	UTSW	9	72677386	missense	probably damaging	1.00
R1633:Nedd4	UTSW	9	72671257	missense	possibly damaging	0.50
R1764:Nedd4	UTSW	9	72730907	missense	probably damaging	0.99
R2192:Nedd4	UTSW	9	72742718	missense	probably damaging	0.99
R2196:Nedd4	UTSW	9	72725074	missense	possibly damaging	0.77
R2220:Nedd4	UTSW	9	72736707	missense	probably damaging	1.00
R2850:Nedd4	UTSW	9	72725074	missense	possibly damaging	0.77
R2994:Nedd4	UTSW	9	72730903	missense	probably benign	0.04
R3040:Nedd4	UTSW	9	72669961	missense	probably benign
R3697:Nedd4	UTSW	9	72740187	missense	probably damaging	1.00
R3884:Nedd4	UTSW	9	72725077	missense	probably benign	0.16
R4475:Nedd4	UTSW	9	72671239	nonsense	probably null
R4883:Nedd4	UTSW	9	72740233	splice site	probably null
R5066:Nedd4	UTSW	9	72710519	missense	probably damaging	1.00
R5947:Nedd4	UTSW	9	72730850	intron	probably benign
R5974:Nedd4	UTSW	9	72743638	critical splice donor site	probably null
R6247:Nedd4	UTSW	9	72726438	missense	probably damaging	1.00
R6651:Nedd4	UTSW	9	72731271	missense	possibly damaging	0.49
R6661:Nedd4	UTSW	9	72686095	missense	probably damaging	1.00
R7170:Nedd4	UTSW	9	72670099	missense	probably benign	0.00
R7237:Nedd4	UTSW	9	72725064	missense	probably benign	0.04
R7653:Nedd4	UTSW	9	72743628	missense	probably damaging	1.00
R7772:Nedd4	UTSW	9	72677326	missense	possibly damaging	0.77
R7905:Nedd4	UTSW	9	72677379	nonsense	probably null
R8194:Nedd4	UTSW	9	72686107	missense	probably damaging	1.00
R8229:Nedd4	UTSW	9	72731388	missense	probably benign	0.00
R8422:Nedd4	UTSW	9	72742682	missense	probably damaging	0.99
R8487:Nedd4	UTSW	9	72670039	missense	probably damaging	0.98
R8733:Nedd4	UTSW	9	72726484	missense	possibly damaging	0.80
R8956:Nedd4	UTSW	9	72726426	missense	probably benign	0.03
R9261:Nedd4	UTSW	9	72677374	missense	possibly damaging	0.93
R9447:Nedd4	UTSW	9	72670099	missense	probably benign
Z1088:Nedd4	UTSW	9	72670078	missense	probably benign	0.22

Predicted Primers

PCR Primer
(F):5'- CACAGCAACAGTGGTAACTTCC -3'
(R):5'- GGATCTCACTGTGTACCAAAATTTGC -3'

Sequencing Primer
(F):5'- ATGGTGGCTCACAACCATCTG -3'
(R):5'- ACCAAAATTTGCTACTATCACTCAG -3'

Posted On

2015-07-21