Incidental Mutation 'R4476:Nedd4'
ID330566
Institutional Source Beutler Lab
Gene Symbol Nedd4
Ensembl Gene ENSMUSG00000032216
Gene Nameneural precursor cell expressed, developmentally down-regulated 4
SynonymsNedd4, Nedd4-1, Nedd4a
MMRRC Submission 041733-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4476 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location72662346-72749852 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 72671239 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 78 (R78*)
Ref Sequence ENSEMBL: ENSMUSP00000138983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034740] [ENSMUST00000183375] [ENSMUST00000184333] [ENSMUST00000184450]
Predicted Effect probably null
Transcript: ENSMUST00000034740
AA Change: R78*
SMART Domains Protein: ENSMUSP00000034740
Gene: ENSMUSG00000032216
AA Change: R78*

DomainStartEndE-ValueType
C2 79 181 5.38e-21 SMART
WW 250 282 2.32e-13 SMART
low complexity region 283 293 N/A INTRINSIC
WW 406 438 1.31e-12 SMART
WW 461 493 1.26e-14 SMART
HECTc 550 886 2.37e-194 SMART
Predicted Effect probably null
Transcript: ENSMUST00000183375
AA Change: R78*
SMART Domains Protein: ENSMUSP00000138852
Gene: ENSMUSG00000032216
AA Change: R78*

DomainStartEndE-ValueType
C2 79 163 1.12e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184180
Predicted Effect probably benign
Transcript: ENSMUST00000184333
SMART Domains Protein: ENSMUSP00000139190
Gene: ENSMUSG00000032216

DomainStartEndE-ValueType
C2 4 71 3.38e-4 SMART
WW 140 172 2.32e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000184450
AA Change: R78*
SMART Domains Protein: ENSMUSP00000138983
Gene: ENSMUSG00000032216
AA Change: R78*

DomainStartEndE-ValueType
C2 79 181 5.38e-21 SMART
WW 250 282 2.32e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184737
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in neonatal lethality and heterozygous mice have decreased body weights. Mice homozygous for a knockout allele exhibit impaired neurite development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,645,330 R275G probably damaging Het
Actc1 T C 2: 114,049,226 T251A probably benign Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Arsb C T 13: 93,807,595 R265C probably damaging Het
Cntn6 A G 6: 104,772,561 E319G probably damaging Het
Cracr2a T A 6: 127,629,819 N275K probably benign Het
Crispld1 G T 1: 17,747,510 W212C probably damaging Het
Exosc10 G A 4: 148,565,324 D404N probably damaging Het
Gfpt2 T C 11: 49,824,342 V388A probably benign Het
Gm14401 C T 2: 177,086,777 R219* probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itgb1bp1 T C 12: 21,270,956 E178G probably benign Het
Kidins220 C T 12: 25,011,001 S826L probably damaging Het
Krt90 T C 15: 101,557,283 D301G probably damaging Het
Me3 T A 7: 89,739,860 V124E probably damaging Het
Neto1 A T 18: 86,404,673 D85V probably damaging Het
Olfr1288 T A 2: 111,479,664 D293E possibly damaging Het
Olfr361 G A 2: 37,085,061 S229L probably damaging Het
Olfr538 T C 7: 140,574,929 Y259H probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Pkd1 A G 17: 24,576,526 E2331G probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Rab23 A G 1: 33,724,892 probably benign Het
Sim2 T C 16: 94,125,791 S625P probably benign Het
Sox18 T C 2: 181,670,876 K154R probably damaging Het
Tanc1 A G 2: 59,841,996 probably null Het
Ugt1a10 TAAAAAAAAA TAAAAAAA 1: 88,215,928 probably benign Het
Zfp667 A G 7: 6,304,599 K89E possibly damaging Het
Other mutations in Nedd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Nedd4 APN 9 72735089 missense probably damaging 1.00
IGL00573:Nedd4 APN 9 72686056 splice site probably null
IGL01973:Nedd4 APN 9 72736934 missense possibly damaging 0.81
IGL02177:Nedd4 APN 9 72747157 missense probably damaging 1.00
IGL03082:Nedd4 APN 9 72677394 critical splice donor site probably null
Evaporation UTSW 9 72686095 missense probably damaging 1.00
reduction UTSW 9 72731271 missense possibly damaging 0.49
R0194:Nedd4 UTSW 9 72670053 missense possibly damaging 0.72
R0714:Nedd4 UTSW 9 72731446 splice site probably benign
R1331:Nedd4 UTSW 9 72677386 missense probably damaging 1.00
R1633:Nedd4 UTSW 9 72671257 missense possibly damaging 0.50
R1764:Nedd4 UTSW 9 72730907 missense probably damaging 0.99
R2192:Nedd4 UTSW 9 72742718 missense probably damaging 0.99
R2196:Nedd4 UTSW 9 72725074 missense possibly damaging 0.77
R2220:Nedd4 UTSW 9 72736707 missense probably damaging 1.00
R2850:Nedd4 UTSW 9 72725074 missense possibly damaging 0.77
R2994:Nedd4 UTSW 9 72730903 missense probably benign 0.04
R3040:Nedd4 UTSW 9 72669961 missense probably benign
R3697:Nedd4 UTSW 9 72740187 missense probably damaging 1.00
R3884:Nedd4 UTSW 9 72725077 missense probably benign 0.16
R4475:Nedd4 UTSW 9 72671239 nonsense probably null
R4883:Nedd4 UTSW 9 72740233 splice site probably null
R5066:Nedd4 UTSW 9 72710519 missense probably damaging 1.00
R5947:Nedd4 UTSW 9 72730850 intron probably benign
R5974:Nedd4 UTSW 9 72743638 critical splice donor site probably null
R6247:Nedd4 UTSW 9 72726438 missense probably damaging 1.00
R6651:Nedd4 UTSW 9 72731271 missense possibly damaging 0.49
R6661:Nedd4 UTSW 9 72686095 missense probably damaging 1.00
R7170:Nedd4 UTSW 9 72670099 missense probably benign 0.00
R7237:Nedd4 UTSW 9 72725064 missense probably benign 0.04
R7653:Nedd4 UTSW 9 72743628 missense probably damaging 1.00
R7772:Nedd4 UTSW 9 72677326 missense possibly damaging 0.77
R7905:Nedd4 UTSW 9 72677379 nonsense probably null
R7988:Nedd4 UTSW 9 72677379 nonsense probably null
Z1088:Nedd4 UTSW 9 72670078 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CACAGCAACAGTGGTAACTTCC -3'
(R):5'- GGATCTCACTGTGTACCAAAATTTGC -3'

Sequencing Primer
(F):5'- ATGGTGGCTCACAACCATCTG -3'
(R):5'- ACCAAAATTTGCTACTATCACTCAG -3'
Posted On2015-07-21