Incidental Mutation 'R4476:Gfpt2'
ID330568
Institutional Source Beutler Lab
Gene Symbol Gfpt2
Ensembl Gene ENSMUSG00000020363
Gene Nameglutamine fructose-6-phosphate transaminase 2
SynonymsGFAT2
MMRRC Submission 041733-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4476 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49794178-49838613 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49824342 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 388 (V388A)
Ref Sequence ENSEMBL: ENSMUSP00000020629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020629]
Predicted Effect probably benign
Transcript: ENSMUST00000020629
AA Change: V388A

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020629
Gene: ENSMUSG00000020363
AA Change: V388A

DomainStartEndE-ValueType
Pfam:GATase_6 72 212 1e-19 PFAM
Pfam:GATase_4 75 206 1.6e-7 PFAM
Pfam:GATase_7 90 209 8.2e-16 PFAM
Pfam:SIS 363 492 1.7e-38 PFAM
Pfam:SIS 534 665 1.2e-29 PFAM
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,645,330 R275G probably damaging Het
Actc1 T C 2: 114,049,226 T251A probably benign Het
Alpk1 T C 3: 127,680,018 T779A probably damaging Het
Arsb C T 13: 93,807,595 R265C probably damaging Het
Cntn6 A G 6: 104,772,561 E319G probably damaging Het
Cracr2a T A 6: 127,629,819 N275K probably benign Het
Crispld1 G T 1: 17,747,510 W212C probably damaging Het
Exosc10 G A 4: 148,565,324 D404N probably damaging Het
Gm14401 C T 2: 177,086,777 R219* probably null Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itgb1bp1 T C 12: 21,270,956 E178G probably benign Het
Kidins220 C T 12: 25,011,001 S826L probably damaging Het
Krt90 T C 15: 101,557,283 D301G probably damaging Het
Me3 T A 7: 89,739,860 V124E probably damaging Het
Nedd4 C T 9: 72,671,239 R78* probably null Het
Neto1 A T 18: 86,404,673 D85V probably damaging Het
Olfr1288 T A 2: 111,479,664 D293E possibly damaging Het
Olfr361 G A 2: 37,085,061 S229L probably damaging Het
Olfr538 T C 7: 140,574,929 Y259H probably damaging Het
Parn A G 16: 13,664,685 S100P probably benign Het
Pkd1 A G 17: 24,576,526 E2331G probably damaging Het
Rab22a C T 2: 173,695,263 T85M probably damaging Het
Rab23 A G 1: 33,724,892 probably benign Het
Sim2 T C 16: 94,125,791 S625P probably benign Het
Sox18 T C 2: 181,670,876 K154R probably damaging Het
Tanc1 A G 2: 59,841,996 probably null Het
Ugt1a10 TAAAAAAAAA TAAAAAAA 1: 88,215,928 probably benign Het
Zfp667 A G 7: 6,304,599 K89E possibly damaging Het
Other mutations in Gfpt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Gfpt2 APN 11 49809123 missense probably benign 0.00
IGL01451:Gfpt2 APN 11 49807690 splice site probably benign
IGL01490:Gfpt2 APN 11 49827127 splice site probably benign
IGL01550:Gfpt2 APN 11 49824323 splice site probably null
IGL01552:Gfpt2 APN 11 49805005 nonsense probably null
IGL02349:Gfpt2 APN 11 49807703 missense probably benign 0.02
IGL02815:Gfpt2 APN 11 49823257 missense possibly damaging 0.89
R0525:Gfpt2 UTSW 11 49829775 missense probably benign 0.06
R0539:Gfpt2 UTSW 11 49832898 missense probably damaging 1.00
R1055:Gfpt2 UTSW 11 49827211 missense probably damaging 1.00
R1178:Gfpt2 UTSW 11 49823309 missense probably benign 0.42
R1340:Gfpt2 UTSW 11 49832861 missense probably damaging 1.00
R2372:Gfpt2 UTSW 11 49807715 missense probably benign 0.00
R4154:Gfpt2 UTSW 11 49835778 splice site probably null
R4679:Gfpt2 UTSW 11 49823737 missense probably benign 0.00
R4863:Gfpt2 UTSW 11 49810970 missense probably benign 0.06
R5113:Gfpt2 UTSW 11 49823799 missense probably damaging 1.00
R5509:Gfpt2 UTSW 11 49827146 missense possibly damaging 0.75
R5830:Gfpt2 UTSW 11 49809061 missense probably benign 0.03
R6435:Gfpt2 UTSW 11 49835651 missense probably benign 0.00
R7079:Gfpt2 UTSW 11 49837751 missense possibly damaging 0.77
R7135:Gfpt2 UTSW 11 49804955 missense probably damaging 1.00
R7261:Gfpt2 UTSW 11 49823251 missense possibly damaging 0.77
R7294:Gfpt2 UTSW 11 49818608 nonsense probably null
R7384:Gfpt2 UTSW 11 49810990 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- CCCATGAACCAGCTTGAGAAG -3'
(R):5'- GATGCACAGAGGATTCACTGG -3'

Sequencing Primer
(F):5'- GCTTGAGAAGTATACTGAGCCCTTTC -3'
(R):5'- TGCACAGAGGATTCACTGGAAGAAG -3'
Posted On2015-07-21