Mutagenetix > Incidental Mutation

Incidental Mutation 'R4476:Kidins220'

330569

Institutional Source

Beutler Lab

Gene Symbol

Kidins220

Ensembl Gene

ENSMUSG00000036333

Gene Name

kinase D-interacting substrate 220

Synonyms

C330002I19Rik, 3110039L19Rik

MMRRC Submission

041733-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4476 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25024924-25113151 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 25061000 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 826 (S826L)

Ref Sequence

ENSEMBL: ENSMUSP00000152683 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066652] [ENSMUST00000220459] [ENSMUST00000222941]

AlphaFold

E9Q9B7

Predicted Effect

probably damaging
Transcript: ENSMUST00000066652
AA Change: S826L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000063999
Gene: ENSMUSG00000036333
AA Change: S826L

Domain	Start	End	E-Value	Type
ANK	37	66	1.11e-7	SMART
ANK	70	99	2.25e-3	SMART
ANK	103	132	4.78e-7	SMART
ANK	136	165	5.53e-3	SMART
ANK	169	198	2.52e-6	SMART
ANK	202	231	6.26e-2	SMART
ANK	235	264	1.22e-4	SMART
ANK	268	297	6.92e-4	SMART
ANK	301	330	1.57e-2	SMART
ANK	334	363	9.78e-4	SMART
ANK	367	398	4.6e0	SMART
Pfam:KAP_NTPase	440	953	1.2e-112	PFAM
low complexity region	1077	1092	N/A	INTRINSIC
low complexity region	1096	1107	N/A	INTRINSIC
low complexity region	1382	1396	N/A	INTRINSIC
low complexity region	1422	1452	N/A	INTRINSIC
low complexity region	1509	1520	N/A	INTRINSIC
low complexity region	1544	1555	N/A	INTRINSIC
low complexity region	1561	1567	N/A	INTRINSIC
low complexity region	1596	1609	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000220459
AA Change: S784L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

unknown
Transcript: ENSMUST00000222013
AA Change: S655L

Predicted Effect

probably damaging
Transcript: ENSMUST00000222941
AA Change: S826L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.6705

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 94.2%

Validation Efficiency

98% (41/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is preferentially expressed in the nervous system where it controls neuronal cell survival, differentiation into exons and dendrites, and synaptic plasticity. The encoded protein interacts with membrane receptors, cytosolic signaling components, and cytoskeletal proteins, serving as a scaffold that mediates crosstalk between the neurotrophin pathway and several other intracellular signaling pathways. Aberrant expression of this gene is associated with the onset of various neuropsychiatric disorders and neurodegenerative diseases, including Alzheimer's disease. Naturally occurring mutations in this gene are associated with a syndrome characterized by spastic paraplegia, intellectual disability, nystagmus and obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for a knock-out allele exhibit decreased dendritic complexity in the barrel somatosensory cortex and dentate gyrus neurons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acin1	T	C	14: 54,882,787 (GRCm39)	R275G	probably damaging	Het
Actc1	T	C	2: 113,879,707 (GRCm39)	T251A	probably benign	Het
Alpk1	T	C	3: 127,473,667 (GRCm39)	T779A	probably damaging	Het
Arsb	C	T	13: 93,944,103 (GRCm39)	R265C	probably damaging	Het
Cntn6	A	G	6: 104,749,522 (GRCm39)	E319G	probably damaging	Het
Cracr2a	T	A	6: 127,606,782 (GRCm39)	N275K	probably benign	Het
Crispld1	G	T	1: 17,817,734 (GRCm39)	W212C	probably damaging	Het
Exosc10	G	A	4: 148,649,781 (GRCm39)	D404N	probably damaging	Het
Gfpt2	T	C	11: 49,715,169 (GRCm39)	V388A	probably benign	Het
Gm14401	C	T	2: 176,778,570 (GRCm39)	R219*	probably null	Het
Hivep2	C	A	10: 14,004,713 (GRCm39)	T437K	probably benign	Het
Itgb1bp1	T	C	12: 21,320,957 (GRCm39)	E178G	probably benign	Het
Krt90	T	C	15: 101,465,718 (GRCm39)	D301G	probably damaging	Het
Me3	T	A	7: 89,389,068 (GRCm39)	V124E	probably damaging	Het
Nedd4	C	T	9: 72,578,521 (GRCm39)	R78*	probably null	Het
Neto1	A	T	18: 86,422,798 (GRCm39)	D85V	probably damaging	Het
Or12k8	G	A	2: 36,975,073 (GRCm39)	S229L	probably damaging	Het
Or13a24	T	C	7: 140,154,842 (GRCm39)	Y259H	probably damaging	Het
Or4g7	T	A	2: 111,310,009 (GRCm39)	D293E	possibly damaging	Het
Parn	A	G	16: 13,482,549 (GRCm39)	S100P	probably benign	Het
Pkd1	A	G	17: 24,795,500 (GRCm39)	E2331G	probably damaging	Het
Rab22a	C	T	2: 173,537,056 (GRCm39)	T85M	probably damaging	Het
Rab23	A	G	1: 33,763,973 (GRCm39)		probably benign	Het
Sim2	T	C	16: 93,926,650 (GRCm39)	S625P	probably benign	Het
Sox18	T	C	2: 181,312,669 (GRCm39)	K154R	probably damaging	Het
Tanc1	A	G	2: 59,672,340 (GRCm39)		probably null	Het
Ugt1a10	TAAAAAAAAA	TAAAAAAA	1: 88,143,650 (GRCm39)		probably benign	Het
Zfp667	A	G	7: 6,307,598 (GRCm39)	K89E	possibly damaging	Het

Other mutations in Kidins220

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Kidins220	APN	12	25,088,559 (GRCm39)	splice site	probably benign
IGL00959:Kidins220	APN	12	25,101,132 (GRCm39)	missense	possibly damaging	0.74
IGL00978:Kidins220	APN	12	25,107,473 (GRCm39)	missense	probably damaging	1.00
IGL01144:Kidins220	APN	12	25,060,925 (GRCm39)	missense	probably damaging	1.00
IGL01326:Kidins220	APN	12	25,088,498 (GRCm39)	missense	probably damaging	0.97
IGL01545:Kidins220	APN	12	25,090,459 (GRCm39)	missense	possibly damaging	0.66
IGL01802:Kidins220	APN	12	25,044,999 (GRCm39)	missense	probably damaging	1.00
IGL01875:Kidins220	APN	12	25,107,728 (GRCm39)	missense	probably benign	0.00
IGL02160:Kidins220	APN	12	25,054,110 (GRCm39)	missense	probably damaging	1.00
IGL02383:Kidins220	APN	12	25,047,332 (GRCm39)	splice site	probably benign
IGL02673:Kidins220	APN	12	25,044,991 (GRCm39)	missense	probably damaging	1.00
IGL02800:Kidins220	APN	12	25,053,092 (GRCm39)	missense	probably damaging	1.00
IGL03345:Kidins220	APN	12	25,053,044 (GRCm39)	missense	probably damaging	1.00
IGL03379:Kidins220	APN	12	25,058,447 (GRCm39)	missense	probably damaging	0.99
IGL03412:Kidins220	APN	12	25,049,344 (GRCm39)	missense	probably damaging	1.00
P0043:Kidins220	UTSW	12	25,058,155 (GRCm39)	missense	probably damaging	1.00
R0011:Kidins220	UTSW	12	25,049,351 (GRCm39)	missense	probably damaging	0.99
R0011:Kidins220	UTSW	12	25,049,351 (GRCm39)	missense	probably damaging	0.99
R0269:Kidins220	UTSW	12	25,090,511 (GRCm39)	missense	probably damaging	0.98
R0280:Kidins220	UTSW	12	25,060,140 (GRCm39)	missense	probably damaging	1.00
R0334:Kidins220	UTSW	12	25,058,068 (GRCm39)	missense	probably damaging	1.00
R1601:Kidins220	UTSW	12	25,055,087 (GRCm39)	missense	probably benign	0.35
R1778:Kidins220	UTSW	12	25,063,445 (GRCm39)	splice site	probably benign
R1808:Kidins220	UTSW	12	25,053,008 (GRCm39)	missense	probably benign	0.00
R1855:Kidins220	UTSW	12	25,106,590 (GRCm39)	missense	probably damaging	1.00
R1965:Kidins220	UTSW	12	25,044,905 (GRCm39)	missense	probably damaging	1.00
R1982:Kidins220	UTSW	12	25,101,193 (GRCm39)	missense	probably benign	0.01
R2069:Kidins220	UTSW	12	25,037,005 (GRCm39)	splice site	probably benign
R2101:Kidins220	UTSW	12	25,107,422 (GRCm39)	missense	probably damaging	1.00
R2124:Kidins220	UTSW	12	25,091,302 (GRCm39)	critical splice donor site	probably null
R2371:Kidins220	UTSW	12	25,107,323 (GRCm39)	missense	probably damaging	1.00
R2405:Kidins220	UTSW	12	25,061,508 (GRCm39)	missense	probably damaging	0.99
R3522:Kidins220	UTSW	12	25,040,757 (GRCm39)	missense	probably damaging	1.00
R3877:Kidins220	UTSW	12	25,051,564 (GRCm39)	splice site	probably benign
R3915:Kidins220	UTSW	12	25,103,957 (GRCm39)	missense	possibly damaging	0.93
R4023:Kidins220	UTSW	12	25,107,143 (GRCm39)	splice site	probably null
R4287:Kidins220	UTSW	12	25,106,845 (GRCm39)	missense	possibly damaging	0.81
R4495:Kidins220	UTSW	12	25,088,301 (GRCm39)	splice site	probably null
R4627:Kidins220	UTSW	12	25,107,041 (GRCm39)	missense	possibly damaging	0.89
R4807:Kidins220	UTSW	12	25,107,284 (GRCm39)	missense	probably damaging	1.00
R4899:Kidins220	UTSW	12	25,063,442 (GRCm39)	critical splice donor site	probably null
R4960:Kidins220	UTSW	12	25,042,259 (GRCm39)	nonsense	probably null
R5118:Kidins220	UTSW	12	25,042,296 (GRCm39)	missense	probably damaging	1.00
R5183:Kidins220	UTSW	12	25,101,125 (GRCm39)	missense	probably benign	0.17
R5238:Kidins220	UTSW	12	25,053,009 (GRCm39)	missense	probably benign	0.31
R5580:Kidins220	UTSW	12	25,097,896 (GRCm39)	missense	probably benign	0.00
R5707:Kidins220	UTSW	12	25,063,390 (GRCm39)	missense	probably damaging	1.00
R5813:Kidins220	UTSW	12	25,107,139 (GRCm39)	nonsense	probably null
R6131:Kidins220	UTSW	12	25,042,313 (GRCm39)	splice site	probably null
R6146:Kidins220	UTSW	12	25,102,812 (GRCm39)	missense	probably damaging	1.00
R6151:Kidins220	UTSW	12	25,106,908 (GRCm39)	missense	possibly damaging	0.65
R6160:Kidins220	UTSW	12	25,047,310 (GRCm39)	missense	probably damaging	1.00
R6187:Kidins220	UTSW	12	25,101,307 (GRCm39)	splice site	probably null
R6289:Kidins220	UTSW	12	25,106,615 (GRCm39)	missense	probably damaging	1.00
R6321:Kidins220	UTSW	12	25,107,533 (GRCm39)	missense	probably benign	0.09
R6450:Kidins220	UTSW	12	25,107,190 (GRCm39)	missense	probably benign
R6513:Kidins220	UTSW	12	25,088,434 (GRCm39)	missense	possibly damaging	0.94
R6652:Kidins220	UTSW	12	25,060,059 (GRCm39)	splice site	probably null
R6711:Kidins220	UTSW	12	25,048,750 (GRCm39)	missense	probably damaging	0.96
R6858:Kidins220	UTSW	12	25,058,542 (GRCm39)	missense	possibly damaging	0.85
R7102:Kidins220	UTSW	12	25,107,662 (GRCm39)	missense	probably benign	0.00
R7112:Kidins220	UTSW	12	25,054,018 (GRCm39)	missense	probably damaging	1.00
R7139:Kidins220	UTSW	12	25,044,820 (GRCm39)	missense	probably damaging	1.00
R7140:Kidins220	UTSW	12	25,086,623 (GRCm39)	missense	probably damaging	1.00
R7271:Kidins220	UTSW	12	25,061,570 (GRCm39)	missense	probably benign	0.21
R7361:Kidins220	UTSW	12	25,106,999 (GRCm39)	missense	probably benign	0.01
R7509:Kidins220	UTSW	12	25,032,360 (GRCm39)	missense	probably damaging	0.98
R7510:Kidins220	UTSW	12	25,042,268 (GRCm39)	missense	possibly damaging	0.88
R7783:Kidins220	UTSW	12	25,038,555 (GRCm39)	missense	probably damaging	1.00
R7796:Kidins220	UTSW	12	25,032,350 (GRCm39)	missense	probably damaging	0.96
R7831:Kidins220	UTSW	12	25,111,230 (GRCm39)	missense	possibly damaging	0.90
R8074:Kidins220	UTSW	12	25,107,715 (GRCm39)	missense	probably benign	0.29
R8214:Kidins220	UTSW	12	25,044,854 (GRCm39)	missense	probably damaging	1.00
R8304:Kidins220	UTSW	12	25,107,127 (GRCm39)	missense	probably benign	0.01
R8313:Kidins220	UTSW	12	25,054,110 (GRCm39)	missense	probably damaging	1.00
R8346:Kidins220	UTSW	12	25,086,533 (GRCm39)	missense	probably damaging	1.00
R8392:Kidins220	UTSW	12	25,040,727 (GRCm39)	missense	probably damaging	1.00
R8482:Kidins220	UTSW	12	25,090,527 (GRCm39)	missense	probably benign	0.00
R8722:Kidins220	UTSW	12	25,051,593 (GRCm39)	missense	probably benign
R8831:Kidins220	UTSW	12	25,086,454 (GRCm39)	missense	possibly damaging	0.70
R8960:Kidins220	UTSW	12	25,106,914 (GRCm39)	missense	probably benign	0.05
R9193:Kidins220	UTSW	12	25,036,966 (GRCm39)	missense	possibly damaging	0.79
R9267:Kidins220	UTSW	12	25,038,558 (GRCm39)	missense	probably benign	0.29
R9303:Kidins220	UTSW	12	25,107,110 (GRCm39)	missense	probably benign	0.36
R9343:Kidins220	UTSW	12	25,058,078 (GRCm39)	missense	probably damaging	1.00
R9526:Kidins220	UTSW	12	25,088,383 (GRCm39)	missense	probably damaging	1.00
R9644:Kidins220	UTSW	12	25,061,018 (GRCm39)	missense	probably damaging	1.00
R9655:Kidins220	UTSW	12	25,047,295 (GRCm39)	missense	probably damaging	1.00
R9664:Kidins220	UTSW	12	25,106,895 (GRCm39)	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- ACTGTGGGTAGATGATAGCAATC -3'
(R):5'- AAGCTTGAGCACTCTAGGGC -3'

Sequencing Primer
(F):5'- CAGGTCCGAGTTCTGTTT -3'
(R):5'- GAGCACTCTAGGGCTTGATACTTAC -3'

Posted On

2015-07-21