Incidental Mutation 'R4488:Sulf1'
ID330577
Institutional Source Beutler Lab
Gene Symbol Sulf1
Ensembl Gene ENSMUSG00000016918
Gene Namesulfatase 1
Synonyms
MMRRC Submission 041744-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.498) question?
Stock #R4488 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location12692277-12861192 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to T at 12786515 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088585] [ENSMUST00000177608] [ENSMUST00000180062] [ENSMUST00000186051] [ENSMUST00000186405] [ENSMUST00000189541]
Predicted Effect probably benign
Transcript: ENSMUST00000088585
SMART Domains Protein: ENSMUSP00000085949
Gene: ENSMUSG00000016918

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
Pfam:Phosphodiest 61 323 9.2e-11 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 679 5e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177608
SMART Domains Protein: ENSMUSP00000137523
Gene: ENSMUSG00000016918

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 534 678 9.7e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180062
SMART Domains Protein: ENSMUSP00000136014
Gene: ENSMUSG00000016918

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
Pfam:Phosphodiest 61 323 9.2e-11 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 679 5e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186051
SMART Domains Protein: ENSMUSP00000141153
Gene: ENSMUSG00000016918

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.4e-56 PFAM
Pfam:Phosphodiest 61 323 9.6e-8 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 679 1.1e-48 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187376
Predicted Effect probably benign
Transcript: ENSMUST00000189541
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular heparan sulfate endosulfatase. The encoded enzyme selectively removes 6-O-sulfate groups from heparan sulfate chains of heparan sulfate proteoglycans (HSPGs). The enzyme is secreted through the Golgi and is subsequently localized to the cell surface. The expression of this gene may be down-regulated in several types of cancer, including hepatocellular (HCC), ovarian and breast cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a null allele display a slight increase in mortality early in life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,003,933 Q3224L probably null Het
Alkal1 A T 1: 6,359,407 Q26L probably benign Het
Brox A G 1: 183,280,950 L280S probably benign Het
Cep41 A T 6: 30,655,689 probably benign Het
Cryz C A 3: 154,618,457 probably benign Het
Cyp26c1 T C 19: 37,693,210 V487A probably benign Het
Dlx6 T C 6: 6,867,207 M270T probably damaging Het
Glb1 T C 9: 114,443,114 I273T probably damaging Het
Glp1r A C 17: 30,918,931 H112P probably benign Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Hcrtr1 A G 4: 130,135,763 V175A probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kif1bp A G 10: 62,563,027 probably benign Het
Mki67 G A 7: 135,697,671 T1878I probably benign Het
Ncoa6 A G 2: 155,407,476 F1303L possibly damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nutf2 T A 8: 105,876,427 probably null Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Rbm45 T C 2: 76,376,396 S251P probably damaging Het
Rnaset2b A G 17: 6,998,070 Y155C probably damaging Het
Rnf122 A G 8: 31,128,255 T92A probably damaging Het
Rnf220 A G 4: 117,489,814 S134P probably damaging Het
Shprh A T 10: 11,160,471 I351F probably benign Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Svil T C 18: 5,049,067 Y202H probably damaging Het
Tek A G 4: 94,849,756 D681G possibly damaging Het
Tra2a A G 6: 49,252,494 probably benign Het
Vcp A T 4: 42,993,826 I102N probably damaging Het
Vmn2r25 A T 6: 123,822,860 I841N probably damaging Het
Zfp949 T C 9: 88,570,089 S571P probably damaging Het
Zkscan16 A G 4: 58,957,431 E571G possibly damaging Het
Zufsp G A 10: 33,948,964 T174I probably damaging Het
Other mutations in Sulf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Sulf1 APN 1 12820463 missense probably damaging 0.99
IGL00788:Sulf1 APN 1 12848449 missense probably damaging 0.99
IGL00845:Sulf1 APN 1 12796967 missense probably damaging 1.00
IGL01606:Sulf1 APN 1 12836204 missense possibly damaging 0.87
IGL01963:Sulf1 APN 1 12818507 missense probably damaging 1.00
IGL01968:Sulf1 APN 1 12818451 missense probably damaging 1.00
IGL02072:Sulf1 APN 1 12848208 missense probably damaging 1.00
IGL02424:Sulf1 APN 1 12796840 missense probably benign 0.28
IGL02519:Sulf1 APN 1 12838363 nonsense probably null
IGL02601:Sulf1 APN 1 12786645 missense probably damaging 1.00
IGL03066:Sulf1 APN 1 12807944 missense probably damaging 0.99
IGL03200:Sulf1 APN 1 12786617 nonsense probably null
PIT4480001:Sulf1 UTSW 1 12859413 missense probably benign 0.01
PIT4519001:Sulf1 UTSW 1 12848171 missense probably damaging 1.00
R0083:Sulf1 UTSW 1 12817417 missense probably damaging 0.99
R0467:Sulf1 UTSW 1 12796920 missense probably damaging 1.00
R0554:Sulf1 UTSW 1 12805194 missense probably damaging 1.00
R0626:Sulf1 UTSW 1 12817492 splice site probably null
R1083:Sulf1 UTSW 1 12836164 frame shift probably null
R1084:Sulf1 UTSW 1 12836164 frame shift probably null
R1498:Sulf1 UTSW 1 12848350 missense probably damaging 1.00
R1523:Sulf1 UTSW 1 12817350 nonsense probably null
R1854:Sulf1 UTSW 1 12838437 missense probably benign 0.06
R1942:Sulf1 UTSW 1 12848173 missense probably damaging 1.00
R1946:Sulf1 UTSW 1 12796907 missense probably benign 0.04
R1998:Sulf1 UTSW 1 12858834 nonsense probably null
R2034:Sulf1 UTSW 1 12820421 missense probably damaging 1.00
R2068:Sulf1 UTSW 1 12840403 missense probably damaging 1.00
R2113:Sulf1 UTSW 1 12848174 missense probably damaging 0.99
R2277:Sulf1 UTSW 1 12796794 missense probably benign 0.41
R3827:Sulf1 UTSW 1 12817432 missense probably benign
R3874:Sulf1 UTSW 1 12817412 missense probably damaging 1.00
R4619:Sulf1 UTSW 1 12786652 missense probably damaging 1.00
R4743:Sulf1 UTSW 1 12836293 missense probably benign 0.04
R4836:Sulf1 UTSW 1 12842686 missense probably benign 0.02
R4918:Sulf1 UTSW 1 12818496 missense probably damaging 1.00
R4958:Sulf1 UTSW 1 12796910 missense probably benign 0.08
R5216:Sulf1 UTSW 1 12796874 missense probably benign 0.28
R5225:Sulf1 UTSW 1 12841478 missense probably benign
R5427:Sulf1 UTSW 1 12796912 missense possibly damaging 0.84
R5450:Sulf1 UTSW 1 12796907 missense probably benign 0.04
R5909:Sulf1 UTSW 1 12858815 missense possibly damaging 0.94
R5912:Sulf1 UTSW 1 12786752 unclassified probably benign
R5966:Sulf1 UTSW 1 12859412 missense probably benign 0.06
R6339:Sulf1 UTSW 1 12838440 missense probably damaging 1.00
R6841:Sulf1 UTSW 1 12838434 missense probably damaging 1.00
R6880:Sulf1 UTSW 1 12842755 missense probably damaging 1.00
R7110:Sulf1 UTSW 1 12838601 missense probably damaging 1.00
R7255:Sulf1 UTSW 1 12859008 missense probably benign 0.00
R7275:Sulf1 UTSW 1 12850965 utr 3 prime probably null
R7386:Sulf1 UTSW 1 12838361 missense probably benign 0.07
R7611:Sulf1 UTSW 1 12836243 missense probably benign
R7732:Sulf1 UTSW 1 12842789 missense probably benign 0.11
R7796:Sulf1 UTSW 1 12858820 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TTAAAATCTCCCTGGTGGTAGTG -3'
(R):5'- TGGTCGTCAGTGAGCACAAG -3'

Sequencing Primer
(F):5'- GGTCTGCTACCTGTGACTCACAC -3'
(R):5'- CACAAGGATAATATTGGGTCTGATG -3'
Posted On2015-07-21