Incidental Mutation 'R4488:Ngf'
ID330582
Institutional Source Beutler Lab
Gene Symbol Ngf
Ensembl Gene ENSMUSG00000027859
Gene Namenerve growth factor
SynonymsNgfb
MMRRC Submission 041744-MU
Accession Numbers

Ncbi RefSeq: NM_013609.2, NM_001112698.1; MGI:97321

Is this an essential gene? Possibly essential (E-score: 0.688) question?
Stock #R4488 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location102469919-102521013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102520699 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 255 (D255N)
Ref Sequence ENSEMBL: ENSMUSP00000142801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035952] [ENSMUST00000106925] [ENSMUST00000198644]
Predicted Effect probably damaging
Transcript: ENSMUST00000035952
AA Change: D193N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040345
Gene: ENSMUSG00000027859
AA Change: D193N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
NGF 128 232 1.41e-78 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106925
AA Change: D259N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102538
Gene: ENSMUSG00000027859
AA Change: D259N

DomainStartEndE-ValueType
NGF 194 298 1.41e-78 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198644
AA Change: D255N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142801
Gene: ENSMUSG00000027859
AA Change: D255N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
NGF 190 294 7.1e-81 SMART
Meta Mutation Damage Score 0.8248 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 95% (38/40)
MGI Phenotype Strain: 1857535
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. This protein has nerve growth stimulating activity and the complex is involved in the regulation of growth and the differentiation of sympathetic and certain sensory neurons. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy, type 5 (HSAN5), and dysregulation of this gene's expression is associated with allergic rhinitis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit elevated pain threshold, loss of neurons in both sensory and sympathetic ganglia, but diminished apoptosis in the retina and spinal cord. Heterozygotes exhibit a substantially reduced number of sympathetic neurons. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,003,933 Q3224L probably null Het
Alkal1 A T 1: 6,359,407 Q26L probably benign Het
Brox A G 1: 183,280,950 L280S probably benign Het
Cep41 A T 6: 30,655,689 probably benign Het
Cryz C A 3: 154,618,457 probably benign Het
Cyp26c1 T C 19: 37,693,210 V487A probably benign Het
Dlx6 T C 6: 6,867,207 M270T probably damaging Het
Glb1 T C 9: 114,443,114 I273T probably damaging Het
Glp1r A C 17: 30,918,931 H112P probably benign Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Hcrtr1 A G 4: 130,135,763 V175A probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kif1bp A G 10: 62,563,027 probably benign Het
Mki67 G A 7: 135,697,671 T1878I probably benign Het
Ncoa6 A G 2: 155,407,476 F1303L possibly damaging Het
Nutf2 T A 8: 105,876,427 probably null Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Rbm45 T C 2: 76,376,396 S251P probably damaging Het
Rnaset2b A G 17: 6,998,070 Y155C probably damaging Het
Rnf122 A G 8: 31,128,255 T92A probably damaging Het
Rnf220 A G 4: 117,489,814 S134P probably damaging Het
Shprh A T 10: 11,160,471 I351F probably benign Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Sulf1 G T 1: 12,786,515 probably benign Het
Svil T C 18: 5,049,067 Y202H probably damaging Het
Tek A G 4: 94,849,756 D681G possibly damaging Het
Tra2a A G 6: 49,252,494 probably benign Het
Vcp A T 4: 42,993,826 I102N probably damaging Het
Vmn2r25 A T 6: 123,822,860 I841N probably damaging Het
Zfp949 T C 9: 88,570,089 S571P probably damaging Het
Zkscan16 A G 4: 58,957,431 E571G possibly damaging Het
Zufsp G A 10: 33,948,964 T174I probably damaging Het
Other mutations in Ngf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Ngf APN 3 102520472 missense probably damaging 0.99
IGL01344:Ngf APN 3 102520312 missense probably benign 0.00
R0049:Ngf UTSW 3 102520345 nonsense probably null
R0049:Ngf UTSW 3 102520345 nonsense probably null
R0147:Ngf UTSW 3 102509803 intron probably benign
R0148:Ngf UTSW 3 102509803 intron probably benign
R0149:Ngf UTSW 3 102520446 missense probably benign 0.13
R1769:Ngf UTSW 3 102520197 missense possibly damaging 0.87
R4357:Ngf UTSW 3 102520205 missense probably benign 0.22
R4486:Ngf UTSW 3 102520699 missense probably damaging 1.00
R4487:Ngf UTSW 3 102520699 missense probably damaging 1.00
R4817:Ngf UTSW 3 102509840 intron probably benign
R4883:Ngf UTSW 3 102520645 missense probably damaging 1.00
R4938:Ngf UTSW 3 102520474 missense probably damaging 1.00
R5158:Ngf UTSW 3 102520129 missense possibly damaging 0.82
R5681:Ngf UTSW 3 102520353 missense probably damaging 1.00
R6259:Ngf UTSW 3 102509797 intron probably benign
R7790:Ngf UTSW 3 102509824 missense unknown
Predicted Primers PCR Primer
(F):5'- TCAGTGTGTGACAGTGTCAG -3'
(R):5'- AAGTGTCGGTATACAGGATGC -3'

Sequencing Primer
(F):5'- CAGTGTGTGGGTTGGAGATAAGAC -3'
(R):5'- ATAATTTACAGGCTGAGGTAGGG -3'
Posted On2015-07-21