Incidental Mutation 'R4488:Zkscan16'
ID330584
Institutional Source Beutler Lab
Gene Symbol Zkscan16
Ensembl Gene ENSMUSG00000038630
Gene Namezinc finger with KRAB and SCAN domains 16
SynonymsZfp483
MMRRC Submission 041744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R4488 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location58943628-58958355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58957431 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 571 (E571G)
Ref Sequence ENSEMBL: ENSMUSP00000103178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107554]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107554
AA Change: E571G

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103178
Gene: ENSMUSG00000038630
AA Change: E571G

DomainStartEndE-ValueType
SCAN 44 153 1.9e-42 SMART
KRAB 170 230 1.66e-20 SMART
internal_repeat_1 281 452 7.49e-5 PROSPERO
ZnF_C2H2 483 505 4.79e-3 SMART
ZnF_C2H2 511 533 2.75e-3 SMART
ZnF_C2H2 539 561 1.6e-4 SMART
ZnF_C2H2 567 589 5.99e-4 SMART
ZnF_C2H2 595 617 1.99e0 SMART
ZnF_C2H2 623 645 5.14e-3 SMART
ZnF_C2H2 651 673 2.65e-5 SMART
ZnF_C2H2 679 701 1.82e-3 SMART
ZnF_C2H2 706 725 4.74e1 SMART
Meta Mutation Damage Score 0.3807 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 95% (38/40)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,003,933 Q3224L probably null Het
Alkal1 A T 1: 6,359,407 Q26L probably benign Het
Brox A G 1: 183,280,950 L280S probably benign Het
Cep41 A T 6: 30,655,689 probably benign Het
Cryz C A 3: 154,618,457 probably benign Het
Cyp26c1 T C 19: 37,693,210 V487A probably benign Het
Dlx6 T C 6: 6,867,207 M270T probably damaging Het
Glb1 T C 9: 114,443,114 I273T probably damaging Het
Glp1r A C 17: 30,918,931 H112P probably benign Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Hcrtr1 A G 4: 130,135,763 V175A probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kif1bp A G 10: 62,563,027 probably benign Het
Mki67 G A 7: 135,697,671 T1878I probably benign Het
Ncoa6 A G 2: 155,407,476 F1303L possibly damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nutf2 T A 8: 105,876,427 probably null Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Rbm45 T C 2: 76,376,396 S251P probably damaging Het
Rnaset2b A G 17: 6,998,070 Y155C probably damaging Het
Rnf122 A G 8: 31,128,255 T92A probably damaging Het
Rnf220 A G 4: 117,489,814 S134P probably damaging Het
Shprh A T 10: 11,160,471 I351F probably benign Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Sulf1 G T 1: 12,786,515 probably benign Het
Svil T C 18: 5,049,067 Y202H probably damaging Het
Tek A G 4: 94,849,756 D681G possibly damaging Het
Tra2a A G 6: 49,252,494 probably benign Het
Vcp A T 4: 42,993,826 I102N probably damaging Het
Vmn2r25 A T 6: 123,822,860 I841N probably damaging Het
Zfp949 T C 9: 88,570,089 S571P probably damaging Het
Zufsp G A 10: 33,948,964 T174I probably damaging Het
Other mutations in Zkscan16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Zkscan16 APN 4 58957709 missense possibly damaging 0.86
IGL01296:Zkscan16 APN 4 58956690 missense possibly damaging 0.53
IGL01330:Zkscan16 APN 4 58956483 missense possibly damaging 0.85
IGL02143:Zkscan16 APN 4 58956911 missense probably damaging 1.00
IGL02901:Zkscan16 APN 4 58946283 missense probably damaging 0.98
IGL03399:Zkscan16 APN 4 58956915 missense probably benign 0.33
R0271:Zkscan16 UTSW 4 58952391 missense probably benign 0.33
R0317:Zkscan16 UTSW 4 58957602 missense possibly damaging 0.86
R0542:Zkscan16 UTSW 4 58956597 missense possibly damaging 0.53
R1417:Zkscan16 UTSW 4 58952377 missense probably benign 0.33
R1674:Zkscan16 UTSW 4 58948918 missense possibly damaging 0.96
R2014:Zkscan16 UTSW 4 58956525 missense possibly damaging 0.96
R2246:Zkscan16 UTSW 4 58957329 missense probably benign 0.09
R2352:Zkscan16 UTSW 4 58951869 missense possibly damaging 0.71
R2851:Zkscan16 UTSW 4 58957364 missense possibly damaging 0.71
R2852:Zkscan16 UTSW 4 58957364 missense possibly damaging 0.71
R3896:Zkscan16 UTSW 4 58946125 start gained probably benign
R4631:Zkscan16 UTSW 4 58951918 missense probably damaging 0.98
R4825:Zkscan16 UTSW 4 58957809 missense possibly damaging 0.73
R4912:Zkscan16 UTSW 4 58946506 missense possibly damaging 0.85
R5014:Zkscan16 UTSW 4 58951892 missense probably damaging 0.97
R5411:Zkscan16 UTSW 4 58956745 frame shift probably null
R5642:Zkscan16 UTSW 4 58957748 missense probably benign 0.11
R5809:Zkscan16 UTSW 4 58946481 missense probably damaging 0.98
R6089:Zkscan16 UTSW 4 58948889 missense possibly damaging 0.85
R6152:Zkscan16 UTSW 4 58946260 missense possibly damaging 0.85
R6469:Zkscan16 UTSW 4 58956483 missense probably damaging 0.98
R7662:Zkscan16 UTSW 4 58957679 nonsense probably null
R7790:Zkscan16 UTSW 4 58951843 nonsense probably null
R8150:Zkscan16 UTSW 4 58952407 missense probably benign 0.06
R8359:Zkscan16 UTSW 4 58957230 missense possibly damaging 0.92
X0020:Zkscan16 UTSW 4 58956747 missense possibly damaging 0.91
Z1176:Zkscan16 UTSW 4 58957052 missense probably damaging 1.00
Z1177:Zkscan16 UTSW 4 58948909 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GACGAATGTGGGAAGCGTTTC -3'
(R):5'- ACCTCAAATGCCGACTGAGG -3'

Sequencing Primer
(F):5'- CCCTACGTGTGTAAACACTGTGG -3'
(R):5'- GGAAACCTTTCTCACAGTGTG -3'
Posted On2015-07-21