Incidental Mutation 'R4488:Tek'
ID330585
Institutional Source Beutler Lab
Gene Symbol Tek
Ensembl Gene ENSMUSG00000006386
Gene NameTEK receptor tyrosine kinase
SynonymsCd202b, Hyk, tie-2, Tie2
MMRRC Submission 041744-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4488 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location94739289-94874976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94849756 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 681 (D681G)
Ref Sequence ENSEMBL: ENSMUSP00000099862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071168] [ENSMUST00000073939] [ENSMUST00000102798]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071168
AA Change: D681G

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000071162
Gene: ENSMUSG00000006386
AA Change: D681G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ig_Tie2_1 23 118 1.2e-57 PFAM
IG_like 128 209 6.52e0 SMART
EGF_Lam 227 264 1.26e-2 SMART
EGF 267 299 2.2e1 SMART
internal_repeat_1 302 346 4.35e-7 PROSPERO
IG_like 356 442 3.29e1 SMART
FN3 445 526 2.11e0 SMART
FN3 541 624 9.77e-5 SMART
FN3 638 720 1.18e-12 SMART
transmembrane domain 747 769 N/A INTRINSIC
TyrKc 822 1090 1.9e-138 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000073939
AA Change: D630G

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073595
Gene: ENSMUSG00000006386
AA Change: D630G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ig_Tie2_1 23 118 7.1e-58 PFAM
EGF_Lam 176 213 1.26e-2 SMART
EGF 216 248 2.2e1 SMART
internal_repeat_1 251 295 4.22e-7 PROSPERO
FN3 394 475 2.11e0 SMART
FN3 490 573 9.77e-5 SMART
FN3 587 669 1.18e-12 SMART
transmembrane domain 696 718 N/A INTRINSIC
TyrKc 772 1040 1.9e-138 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102798
AA Change: D681G

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099862
Gene: ENSMUSG00000006386
AA Change: D681G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ig_Tie2_1 24 118 5e-44 PFAM
IG_like 128 209 6.52e0 SMART
EGF_Lam 227 264 1.26e-2 SMART
EGF 267 299 2.2e1 SMART
internal_repeat_1 302 346 4.36e-7 PROSPERO
IG_like 356 442 3.29e1 SMART
FN3 445 526 2.11e0 SMART
FN3 541 624 9.77e-5 SMART
FN3 638 720 1.18e-12 SMART
transmembrane domain 747 769 N/A INTRINSIC
TyrKc 823 1091 1.9e-138 SMART
Meta Mutation Damage Score 0.0617 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor that belongs to the protein tyrosine kinase Tie2 family. The encoded protein possesses a unique extracellular region that contains two immunoglobulin-like domains, three epidermal growth factor (EGF)-like domains and three fibronectin type III repeats. The ligand angiopoietin-1 binds to this receptor and mediates a signaling pathway that functions in embryonic vascular development. Mutations in this gene are associated with inherited venous malformations of the skin and mucous membranes. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during organogenesis, impaired vascular branching in the embryo and yolk sac, abnormal cardiac development, and in some cases hemorrhages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,003,933 Q3224L probably null Het
Alkal1 A T 1: 6,359,407 Q26L probably benign Het
Brox A G 1: 183,280,950 L280S probably benign Het
Cep41 A T 6: 30,655,689 probably benign Het
Cryz C A 3: 154,618,457 probably benign Het
Cyp26c1 T C 19: 37,693,210 V487A probably benign Het
Dlx6 T C 6: 6,867,207 M270T probably damaging Het
Glb1 T C 9: 114,443,114 I273T probably damaging Het
Glp1r A C 17: 30,918,931 H112P probably benign Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Hcrtr1 A G 4: 130,135,763 V175A probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kif1bp A G 10: 62,563,027 probably benign Het
Mki67 G A 7: 135,697,671 T1878I probably benign Het
Ncoa6 A G 2: 155,407,476 F1303L possibly damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nutf2 T A 8: 105,876,427 probably null Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Rbm45 T C 2: 76,376,396 S251P probably damaging Het
Rnaset2b A G 17: 6,998,070 Y155C probably damaging Het
Rnf122 A G 8: 31,128,255 T92A probably damaging Het
Rnf220 A G 4: 117,489,814 S134P probably damaging Het
Shprh A T 10: 11,160,471 I351F probably benign Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Sulf1 G T 1: 12,786,515 probably benign Het
Svil T C 18: 5,049,067 Y202H probably damaging Het
Tra2a A G 6: 49,252,494 probably benign Het
Vcp A T 4: 42,993,826 I102N probably damaging Het
Vmn2r25 A T 6: 123,822,860 I841N probably damaging Het
Zfp949 T C 9: 88,570,089 S571P probably damaging Het
Zkscan16 A G 4: 58,957,431 E571G possibly damaging Het
Zufsp G A 10: 33,948,964 T174I probably damaging Het
Other mutations in Tek
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Tek APN 4 94827301 missense probably benign 0.03
IGL00805:Tek APN 4 94798719 missense probably damaging 1.00
IGL00806:Tek APN 4 94798719 missense probably damaging 1.00
IGL00807:Tek APN 4 94798719 missense probably damaging 1.00
IGL00870:Tek APN 4 94873081 nonsense probably null
IGL01348:Tek APN 4 94859658 missense probably damaging 1.00
IGL01398:Tek APN 4 94849777 missense probably damaging 1.00
IGL01683:Tek APN 4 94858911 missense probably damaging 1.00
IGL01827:Tek APN 4 94739645 missense probably benign 0.24
IGL02063:Tek APN 4 94739645 missense probably benign 0.24
IGL02218:Tek APN 4 94855337 missense probably damaging 1.00
IGL02502:Tek APN 4 94853581 critical splice donor site probably null
IGL02852:Tek APN 4 94855324 missense probably damaging 1.00
IGL02995:Tek APN 4 94739640 utr 5 prime probably benign
IGL03182:Tek APN 4 94851765 missense probably damaging 1.00
IGL03247:Tek APN 4 94865443 missense possibly damaging 0.85
IGL03014:Tek UTSW 4 94827263 missense probably benign 0.05
R0022:Tek UTSW 4 94837272 missense probably damaging 0.98
R0373:Tek UTSW 4 94804341 missense probably damaging 1.00
R0479:Tek UTSW 4 94804312 missense probably benign 0.01
R1178:Tek UTSW 4 94804287 missense probably damaging 1.00
R1289:Tek UTSW 4 94804830 missense probably damaging 1.00
R1331:Tek UTSW 4 94739706 splice site probably benign
R1502:Tek UTSW 4 94781102 missense probably damaging 1.00
R1606:Tek UTSW 4 94849767 missense probably damaging 0.99
R2073:Tek UTSW 4 94827729 missense probably benign 0.01
R2075:Tek UTSW 4 94827729 missense probably benign 0.01
R2230:Tek UTSW 4 94811336 missense probably damaging 1.00
R2851:Tek UTSW 4 94820224 missense probably benign 0.30
R2852:Tek UTSW 4 94820224 missense probably benign 0.30
R3775:Tek UTSW 4 94804312 missense probably benign 0.01
R3845:Tek UTSW 4 94804872 missense probably damaging 1.00
R4114:Tek UTSW 4 94849683 missense probably damaging 0.99
R4115:Tek UTSW 4 94849683 missense probably damaging 0.99
R4273:Tek UTSW 4 94829970 missense probably damaging 1.00
R4425:Tek UTSW 4 94863667 missense probably damaging 1.00
R4579:Tek UTSW 4 94863666 nonsense probably null
R4623:Tek UTSW 4 94863661 missense probably damaging 1.00
R4651:Tek UTSW 4 94780884 missense probably damaging 1.00
R4652:Tek UTSW 4 94780884 missense probably damaging 1.00
R4723:Tek UTSW 4 94799160 missense possibly damaging 0.71
R5059:Tek UTSW 4 94804314 missense probably benign 0.10
R5652:Tek UTSW 4 94855324 missense probably damaging 1.00
R5793:Tek UTSW 4 94820096 missense probably benign 0.01
R5855:Tek UTSW 4 94853553 missense probably damaging 1.00
R5912:Tek UTSW 4 94798640 missense probably damaging 1.00
R6537:Tek UTSW 4 94837324 missense probably benign 0.19
R6727:Tek UTSW 4 94853495 nonsense probably null
R6835:Tek UTSW 4 94853434 missense possibly damaging 0.94
R6883:Tek UTSW 4 94837189 missense possibly damaging 0.89
R6887:Tek UTSW 4 94804944 missense probably damaging 1.00
R7027:Tek UTSW 4 94865510 missense probably damaging 1.00
R7108:Tek UTSW 4 94853487 missense probably damaging 1.00
R7121:Tek UTSW 4 94811410 missense probably benign 0.19
R7220:Tek UTSW 4 94804304 missense probably damaging 1.00
R7346:Tek UTSW 4 94827296 missense probably benign
R7417:Tek UTSW 4 94811345 missense probably benign
R7465:Tek UTSW 4 94827826 critical splice donor site probably null
R7818:Tek UTSW 4 94827716 missense possibly damaging 0.67
R7917:Tek UTSW 4 94820135 missense possibly damaging 0.89
R8098:Tek UTSW 4 94827670 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GGTAAATGAGTTGACCCGACCC -3'
(R):5'- TACTACCAACCTGGGGAATGTG -3'

Sequencing Primer
(F):5'- TCAACCATCTAATTGGCAGCTG -3'
(R):5'- GGAAGCGTCCTCAGTTCATG -3'
Posted On2015-07-21