Mutagenetix > Incidental Mutations

Incidental Mutation 'R4488:Hcrtr1'

330587

Institutional Source

Beutler Lab

Gene Symbol

Hcrtr1

Ensembl Gene

ENSMUSG00000028778

Gene Name

hypocretin (orexin) receptor 1

Synonyms

OX1R

MMRRC Submission

041744-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.090) question?

Stock #

R4488 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

130130217-130139359 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 130135763 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 175 (V175A)

Ref Sequence

ENSEMBL: ENSMUSP00000127290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030562] [ENSMUST00000119423] [ENSMUST00000120154] [ENSMUST00000164887]

Predicted Effect

probably benign
Transcript: ENSMUST00000030562
AA Change: V175A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000030562
Gene: ENSMUSG00000028778
AA Change: V175A

Domain	Start	End	E-Value	Type
Pfam:7tm_1	63	358	8.8e-59	PFAM
low complexity region	406	415	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119423
AA Change: V175A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000112630
Gene: ENSMUSG00000028778
AA Change: V175A

Domain	Start	End	E-Value	Type
Pfam:7tm_1	63	358	5.3e-56	PFAM
low complexity region	406	415	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120154
AA Change: V175A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000113198
Gene: ENSMUSG00000028778
AA Change: V175A

Domain	Start	End	E-Value	Type
Pfam:7tm_1	63	358	8.8e-59	PFAM
low complexity region	406	415	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164887
AA Change: V175A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000127290
Gene: ENSMUSG00000028778
AA Change: V175A

Domain	Start	End	E-Value	Type
Pfam:7tm_1	63	358	8.8e-59	PFAM
low complexity region	406	415	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

95% (38/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor involved in the regulation of feeding behavior. The encoded protein selectively binds the hypothalamic neuropeptide orexin A. A related gene (HCRTR2) encodes a G-protein coupled receptor that binds orexin A and orexin B. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for one null allele display increased susceptibility to pharmacologically induced seizures. Mice homozygous for a second null allele display a decrease in depression like behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	T	3: 37,003,933	Q3224L	probably null	Het
Alkal1	A	T	1: 6,359,407	Q26L	probably benign	Het
Brox	A	G	1: 183,280,950	L280S	probably benign	Het
Cep41	A	T	6: 30,655,689		probably benign	Het
Cryz	C	A	3: 154,618,457		probably benign	Het
Cyp26c1	T	C	19: 37,693,210	V487A	probably benign	Het
Dlx6	T	C	6: 6,867,207	M270T	probably damaging	Het
Glb1	T	C	9: 114,443,114	I273T	probably damaging	Het
Glp1r	A	C	17: 30,918,931	H112P	probably benign	Het
Grm6	T	C	11: 50,859,989	S660P	probably damaging	Het
Hao2	T	A	3: 98,882,025	I116F	probably damaging	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Kif1bp	A	G	10: 62,563,027		probably benign	Het
Mki67	G	A	7: 135,697,671	T1878I	probably benign	Het
Ncoa6	A	G	2: 155,407,476	F1303L	possibly damaging	Het
Ngf	G	A	3: 102,520,699	D255N	probably damaging	Het
Nutf2	T	A	8: 105,876,427		probably null	Het
Olfr676	T	C	7: 105,035,303	F35S	probably benign	Het
Rbm45	T	C	2: 76,376,396	S251P	probably damaging	Het
Rnaset2b	A	G	17: 6,998,070	Y155C	probably damaging	Het
Rnf122	A	G	8: 31,128,255	T92A	probably damaging	Het
Rnf220	A	G	4: 117,489,814	S134P	probably damaging	Het
Shprh	A	T	10: 11,160,471	I351F	probably benign	Het
Smchd1	T	C	17: 71,407,235	T878A	probably benign	Het
Sulf1	G	T	1: 12,786,515		probably benign	Het
Svil	T	C	18: 5,049,067	Y202H	probably damaging	Het
Tek	A	G	4: 94,849,756	D681G	possibly damaging	Het
Tra2a	A	G	6: 49,252,494		probably benign	Het
Vcp	A	T	4: 42,993,826	I102N	probably damaging	Het
Vmn2r25	A	T	6: 123,822,860	I841N	probably damaging	Het
Zfp949	T	C	9: 88,570,089	S571P	probably damaging	Het
Zkscan16	A	G	4: 58,957,431	E571G	possibly damaging	Het
Zufsp	G	A	10: 33,948,964	T174I	probably damaging	Het

Other mutations in Hcrtr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Hcrtr1	APN	4	130137269	missense	probably damaging	1.00
IGL00754:Hcrtr1	APN	4	130137233	missense	probably damaging	1.00
IGL02005:Hcrtr1	APN	4	130137263	missense	probably benign	0.31
R0084:Hcrtr1	UTSW	4	130137266	missense	possibly damaging	0.79
R0590:Hcrtr1	UTSW	4	130135694	missense	probably damaging	0.96
R1531:Hcrtr1	UTSW	4	130130927	nonsense	probably null
R1659:Hcrtr1	UTSW	4	130135336	nonsense	probably null
R2055:Hcrtr1	UTSW	4	130130887	missense	probably benign	0.08
R3028:Hcrtr1	UTSW	4	130135811	missense	probably benign	0.31
R4967:Hcrtr1	UTSW	4	130130999	missense	possibly damaging	0.69
R5301:Hcrtr1	UTSW	4	130137670	splice site	probably null
R5375:Hcrtr1	UTSW	4	130135725	missense	probably benign	0.08
R5636:Hcrtr1	UTSW	4	130130945	missense	possibly damaging	0.59
R6283:Hcrtr1	UTSW	4	130135340	missense	probably benign	0.01
R6505:Hcrtr1	UTSW	4	130137586	missense	probably benign
R7018:Hcrtr1	UTSW	4	130135868	missense	probably damaging	1.00
R7042:Hcrtr1	UTSW	4	130130860	unclassified	probably benign
R7091:Hcrtr1	UTSW	4	130130914	missense	probably damaging	0.99
R7259:Hcrtr1	UTSW	4	130135818	missense	possibly damaging	0.79
R7612:Hcrtr1	UTSW	4	130135685	missense	possibly damaging	0.61
R8140:Hcrtr1	UTSW	4	130135290	missense	probably damaging	0.99
Z1177:Hcrtr1	UTSW	4	130133873	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATGCTCACACTAGAGGAGATACC -3'
(R):5'- CTGGGCTGTGAACTGTTTCC -3'

Sequencing Primer
(F):5'- GGAGATACCTACCCTGGGG -3'
(R):5'- CCGCCCTACCTCTGATGTTGTG -3'

Posted On

2015-07-21