Incidental Mutation 'R4488:Dlx6'
ID330589
Institutional Source Beutler Lab
Gene Symbol Dlx6
Ensembl Gene ENSMUSG00000029754
Gene Namedistal-less homeobox 6
Synonyms
MMRRC Submission 041744-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4488 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location6863334-6868568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6867207 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 270 (M270T)
Ref Sequence ENSEMBL: ENSMUSP00000128585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031768] [ENSMUST00000160937] [ENSMUST00000171311]
Predicted Effect probably benign
Transcript: ENSMUST00000031768
AA Change: M131T

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000031768
Gene: ENSMUSG00000029754
AA Change: M131T

DomainStartEndE-ValueType
HOX 32 94 7.65e-23 SMART
low complexity region 102 118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159568
Predicted Effect probably damaging
Transcript: ENSMUST00000160937
AA Change: M270T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124204
Gene: ENSMUSG00000029754
AA Change: M270T

DomainStartEndE-ValueType
low complexity region 26 59 N/A INTRINSIC
low complexity region 79 102 N/A INTRINSIC
HOX 171 233 7.65e-23 SMART
low complexity region 241 257 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171311
AA Change: M270T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128585
Gene: ENSMUSG00000029754
AA Change: M270T

DomainStartEndE-ValueType
low complexity region 26 59 N/A INTRINSIC
low complexity region 79 102 N/A INTRINSIC
HOX 171 233 7.65e-23 SMART
low complexity region 241 257 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184182
Meta Mutation Damage Score 0.0711 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a homeobox transcription factor gene family similiar to the Drosophila distal-less gene. This family is comprised of at least 6 different members that encode proteins with roles in forebrain and craniofacial development. This gene is in a tail-to-tail configuration with another member of the family on the long arm of chromosome 7. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations at both Dlx5 and Dlx6 exhibit bilateral ectrodactyly, homeotic transformation of the lower jaw into an upper jaw, and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,003,933 Q3224L probably null Het
Alkal1 A T 1: 6,359,407 Q26L probably benign Het
Brox A G 1: 183,280,950 L280S probably benign Het
Cep41 A T 6: 30,655,689 probably benign Het
Cryz C A 3: 154,618,457 probably benign Het
Cyp26c1 T C 19: 37,693,210 V487A probably benign Het
Glb1 T C 9: 114,443,114 I273T probably damaging Het
Glp1r A C 17: 30,918,931 H112P probably benign Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Hcrtr1 A G 4: 130,135,763 V175A probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kif1bp A G 10: 62,563,027 probably benign Het
Mki67 G A 7: 135,697,671 T1878I probably benign Het
Ncoa6 A G 2: 155,407,476 F1303L possibly damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nutf2 T A 8: 105,876,427 probably null Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Rbm45 T C 2: 76,376,396 S251P probably damaging Het
Rnaset2b A G 17: 6,998,070 Y155C probably damaging Het
Rnf122 A G 8: 31,128,255 T92A probably damaging Het
Rnf220 A G 4: 117,489,814 S134P probably damaging Het
Shprh A T 10: 11,160,471 I351F probably benign Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Sulf1 G T 1: 12,786,515 probably benign Het
Svil T C 18: 5,049,067 Y202H probably damaging Het
Tek A G 4: 94,849,756 D681G possibly damaging Het
Tra2a A G 6: 49,252,494 probably benign Het
Vcp A T 4: 42,993,826 I102N probably damaging Het
Vmn2r25 A T 6: 123,822,860 I841N probably damaging Het
Zfp949 T C 9: 88,570,089 S571P probably damaging Het
Zkscan16 A G 4: 58,957,431 E571G possibly damaging Het
Zufsp G A 10: 33,948,964 T174I probably damaging Het
Other mutations in Dlx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Dlx6 APN 6 6865143 missense probably damaging 1.00
IGL01081:Dlx6 APN 6 6867068 missense probably damaging 1.00
IGL03034:Dlx6 APN 6 6863807 missense probably benign 0.45
IGL03309:Dlx6 APN 6 6867289 missense possibly damaging 0.77
R0848:Dlx6 UTSW 6 6863665 nonsense probably null
R1004:Dlx6 UTSW 6 6863665 nonsense probably null
R1694:Dlx6 UTSW 6 6867173 missense probably damaging 1.00
R1753:Dlx6 UTSW 6 6863665 nonsense probably null
R2076:Dlx6 UTSW 6 6867098 missense probably benign 0.00
R2293:Dlx6 UTSW 6 6867246 missense probably damaging 1.00
R4574:Dlx6 UTSW 6 6865305 intron probably benign
R4942:Dlx6 UTSW 6 6863468 missense probably benign 0.28
R5102:Dlx6 UTSW 6 6865180 frame shift probably null
R5103:Dlx6 UTSW 6 6865180 frame shift probably null
R5104:Dlx6 UTSW 6 6865180 frame shift probably null
R5105:Dlx6 UTSW 6 6865180 frame shift probably null
R5736:Dlx6 UTSW 6 6863660 missense probably damaging 0.97
R7577:Dlx6 UTSW 6 6863423 missense probably damaging 1.00
R7995:Dlx6 UTSW 6 6867277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGTATGATGTTTATCTGGCCTG -3'
(R):5'- AGTTGCTCTGAGCTCAATGC -3'

Sequencing Primer
(F):5'- ACTACATGTCTTGCAGGTGAAG -3'
(R):5'- CTCAATGCTTAGGCTGTTTGGC -3'
Posted On2015-07-21