Incidental Mutation 'R0052:Nlrp3'
ID 33059
Institutional Source Beutler Lab
Gene Symbol Nlrp3
Ensembl Gene ENSMUSG00000032691
Gene Name NLR family, pyrin domain containing 3
Synonyms Mmig1, Cias1, NALP3, cryopyrin, Pypaf1
MMRRC Submission 038346-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R0052 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 59432395-59457781 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 59455954 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 917 (R917*)
Ref Sequence ENSEMBL: ENSMUSP00000098707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148]
AlphaFold Q8R4B8
Predicted Effect probably null
Transcript: ENSMUST00000079476
AA Change: R917*
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: R917*

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000101148
AA Change: R917*
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: R917*

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 T C 19: 23,893,315 (GRCm39) S438P possibly damaging Het
Atosa A G 9: 74,926,265 (GRCm39) probably benign Het
Atp2a1 A G 7: 126,057,069 (GRCm39) probably benign Het
Axin2 T C 11: 108,840,096 (GRCm39) Y735H probably damaging Het
Bicd2 T A 13: 49,528,790 (GRCm39) L184Q probably damaging Het
Bub1 G A 2: 127,650,959 (GRCm39) T618I probably benign Het
Catsperg2 A G 7: 29,424,445 (GRCm39) probably benign Het
Ccdc73 T A 2: 104,759,915 (GRCm39) probably benign Het
Crybg3 A T 16: 59,386,019 (GRCm39) probably benign Het
Dsp A G 13: 38,381,340 (GRCm39) D2096G possibly damaging Het
Eef2 C CN 10: 81,014,602 (GRCm39) probably null Het
Elp3 A G 14: 65,768,975 (GRCm39) *548Q probably null Het
Eno4 A G 19: 58,956,985 (GRCm39) D357G probably damaging Het
Fcrl2 A T 3: 87,164,085 (GRCm39) I348N possibly damaging Het
Fgl2 A T 5: 21,580,347 (GRCm39) S230C probably damaging Het
Ginm1 T A 10: 7,655,070 (GRCm39) E57D possibly damaging Het
Gtf3c1 A T 7: 125,267,143 (GRCm39) probably null Het
Herc1 G T 9: 66,307,438 (GRCm39) G1044V probably damaging Het
Hmcn1 G A 1: 150,553,157 (GRCm39) T2511M probably damaging Het
Iba57 C T 11: 59,049,727 (GRCm39) A207T probably benign Het
Itga9 T A 9: 118,465,617 (GRCm39) I157N probably damaging Het
Kalrn A G 16: 34,177,541 (GRCm39) L208P probably damaging Het
Kcnj10 A G 1: 172,196,491 (GRCm39) T2A probably benign Het
Kdm1b T A 13: 47,217,593 (GRCm39) C351S probably damaging Het
Kif21a T C 15: 90,855,060 (GRCm39) E700G probably damaging Het
Mmd C T 11: 90,150,824 (GRCm39) probably benign Het
Mocs3 C T 2: 168,073,602 (GRCm39) P350S probably benign Het
Morn3 T C 5: 123,184,726 (GRCm39) Y38C probably damaging Het
Nacc1 A T 8: 85,402,854 (GRCm39) V313D probably benign Het
Nbeal1 T A 1: 60,267,771 (GRCm39) probably benign Het
Neb T C 2: 52,163,992 (GRCm39) K1989E possibly damaging Het
Nlrp4b T A 7: 10,459,889 (GRCm39) Y463* probably null Het
Perm1 A T 4: 156,302,572 (GRCm39) D372V probably damaging Het
Phf3 T C 1: 30,847,848 (GRCm39) T1232A probably damaging Het
Phldb3 G A 7: 24,312,004 (GRCm39) R106Q probably benign Het
Pld4 T A 12: 112,734,291 (GRCm39) F386I probably benign Het
Prex2 T A 1: 11,230,380 (GRCm39) L802Q probably damaging Het
Psd3 A G 8: 68,335,631 (GRCm39) probably null Het
Ralgds T A 2: 28,434,400 (GRCm39) probably null Het
Rmdn2 A G 17: 79,957,760 (GRCm39) E16G probably damaging Het
Rnf111 A T 9: 70,383,671 (GRCm39) S87R probably benign Het
Slc4a4 A C 5: 89,304,195 (GRCm39) H502P possibly damaging Het
Slc9c1 A G 16: 45,427,219 (GRCm39) probably benign Het
Slco3a1 A T 7: 74,154,074 (GRCm39) I166N probably benign Het
Snx5 A T 2: 144,101,112 (GRCm39) probably null Het
Srgap1 T C 10: 121,636,732 (GRCm39) D741G possibly damaging Het
St8sia2 G T 7: 73,593,038 (GRCm39) Y339* probably null Het
St8sia2 A T 7: 73,621,700 (GRCm39) W86R probably damaging Het
Stk33 A G 7: 108,878,876 (GRCm39) L491P possibly damaging Het
Sult2a7 T C 7: 14,199,133 (GRCm39) Y298C probably damaging Het
Tdo2 T A 3: 81,874,332 (GRCm39) N210I probably benign Het
Thada A T 17: 84,762,586 (GRCm39) N104K probably damaging Het
Timm8b A T 9: 50,516,330 (GRCm39) D61V possibly damaging Het
Tshz1 G A 18: 84,033,070 (GRCm39) T446I possibly damaging Het
Ubap2l T C 3: 89,946,235 (GRCm39) N123S possibly damaging Het
Vmn1r48 T C 6: 90,013,246 (GRCm39) E193G possibly damaging Het
Vmn1r69 C T 7: 10,314,327 (GRCm39) V135I probably benign Het
Vmn2r103 G T 17: 20,031,903 (GRCm39) G559V probably benign Het
Vmn2r26 T A 6: 124,038,992 (GRCm39) *856R probably null Het
Vmn2r88 A G 14: 51,656,157 (GRCm39) I798V possibly damaging Het
Vsir C T 10: 60,193,861 (GRCm39) A108V probably benign Het
Zfp14 G T 7: 29,737,753 (GRCm39) Q411K probably damaging Het
Zfp236 A T 18: 82,657,457 (GRCm39) M762K probably damaging Het
Zfp462 G A 4: 55,011,762 (GRCm39) G1243S probably benign Het
Other mutations in Nlrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59,456,769 (GRCm39) missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59,455,942 (GRCm39) missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59,442,713 (GRCm39) missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59,440,204 (GRCm39) missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59,440,361 (GRCm39) missense probably benign
IGL02334:Nlrp3 APN 11 59,455,909 (GRCm39) missense probably benign
IGL02417:Nlrp3 APN 11 59,456,849 (GRCm39) unclassified probably benign
IGL02578:Nlrp3 APN 11 59,439,227 (GRCm39) missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59,456,802 (GRCm39) missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59,446,608 (GRCm39) missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59,440,372 (GRCm39) missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59,439,842 (GRCm39) missense probably damaging 1.00
Flogiston UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
nd1 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
Nd14 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd3 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
nd5 UTSW 11 59,456,705 (GRCm39) missense probably benign 0.01
nd6 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
nd7 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd9 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
Park2 UTSW 11 59,455,954 (GRCm39) nonsense probably null
Park3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
Park4 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
Park5 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
Park6 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
Park7 UTSW 11 59,438,836 (GRCm39) nonsense probably null
Park8 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0362:Nlrp3 UTSW 11 59,439,623 (GRCm39) missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59,446,750 (GRCm39) splice site probably benign
R0649:Nlrp3 UTSW 11 59,439,368 (GRCm39) missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59,439,082 (GRCm39) missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59,446,594 (GRCm39) missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59,433,949 (GRCm39) missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59,434,177 (GRCm39) missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59,449,228 (GRCm39) missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59,439,742 (GRCm39) missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59,439,962 (GRCm39) missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59,440,487 (GRCm39) missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59,438,836 (GRCm39) nonsense probably null
R4540:Nlrp3 UTSW 11 59,442,725 (GRCm39) missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59,440,048 (GRCm39) missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59,439,127 (GRCm39) missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59,440,064 (GRCm39) missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59,455,910 (GRCm39) missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59,439,889 (GRCm39) missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59,446,574 (GRCm39) nonsense probably null
R5869:Nlrp3 UTSW 11 59,438,960 (GRCm39) missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59,437,678 (GRCm39) missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59,437,617 (GRCm39) missense probably benign
R5979:Nlrp3 UTSW 11 59,439,797 (GRCm39) missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59,439,392 (GRCm39) missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59,456,018 (GRCm39) missense probably damaging 1.00
R7261:Nlrp3 UTSW 11 59,439,272 (GRCm39) missense possibly damaging 0.83
R7349:Nlrp3 UTSW 11 59,438,912 (GRCm39) missense probably damaging 1.00
R7388:Nlrp3 UTSW 11 59,455,892 (GRCm39) missense probably benign 0.00
R7715:Nlrp3 UTSW 11 59,433,829 (GRCm39) splice site probably null
R7916:Nlrp3 UTSW 11 59,442,689 (GRCm39) missense probably benign 0.00
R8222:Nlrp3 UTSW 11 59,439,614 (GRCm39) missense probably damaging 0.98
R8360:Nlrp3 UTSW 11 59,440,229 (GRCm39) missense probably benign 0.02
R8390:Nlrp3 UTSW 11 59,442,616 (GRCm39) missense possibly damaging 0.47
R8550:Nlrp3 UTSW 11 59,440,097 (GRCm39) missense probably damaging 1.00
R8738:Nlrp3 UTSW 11 59,440,216 (GRCm39) missense probably benign 0.00
R8940:Nlrp3 UTSW 11 59,455,870 (GRCm39) missense probably benign 0.26
R8990:Nlrp3 UTSW 11 59,439,584 (GRCm39) missense probably damaging 0.99
R9324:Nlrp3 UTSW 11 59,434,141 (GRCm39) missense probably damaging 1.00
R9673:Nlrp3 UTSW 11 59,440,148 (GRCm39) missense probably damaging 1.00
RF031:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
RF040:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
Z1088:Nlrp3 UTSW 11 59,442,686 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AAGTTGGAAGGATGCAGCTCGC -3'
(R):5'- AATGAATGTTTGCAGTTGGCAGGAC -3'

Posted On 2013-05-09