Incidental Mutation 'R4488:Tra2a'
ID330591
Institutional Source Beutler Lab
Gene Symbol Tra2a
Ensembl Gene ENSMUSG00000029817
Gene Nametransformer 2 alpha
Synonyms1500010G04Rik, mAWMS1, G430041M01Rik
MMRRC Submission 041744-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.708) question?
Stock #R4488 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location49243924-49264033 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to G at 49252494 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031841] [ENSMUST00000203820] [ENSMUST00000204189]
Predicted Effect unknown
Transcript: ENSMUST00000031841
AA Change: S20P
SMART Domains Protein: ENSMUSP00000031841
Gene: ENSMUSG00000029817
AA Change: S20P

DomainStartEndE-ValueType
low complexity region 29 106 N/A INTRINSIC
RRM 118 191 4.12e-25 SMART
low complexity region 213 282 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203820
Predicted Effect unknown
Transcript: ENSMUST00000204189
AA Change: S20P
SMART Domains Protein: ENSMUSP00000145039
Gene: ENSMUSG00000029817
AA Change: S20P

DomainStartEndE-ValueType
low complexity region 29 106 N/A INTRINSIC
RRM 118 191 1.8e-27 SMART
low complexity region 214 280 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204899
Meta Mutation Damage Score 0.0736 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the transformer 2 homolog family and encodes a protein with several RRM (RNA recognition motif) domains. This phosphorylated nuclear protein binds to specific RNA sequences and plays a role in the regulation of pre-mRNA splicing. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,003,933 Q3224L probably null Het
Alkal1 A T 1: 6,359,407 Q26L probably benign Het
Brox A G 1: 183,280,950 L280S probably benign Het
Cep41 A T 6: 30,655,689 probably benign Het
Cryz C A 3: 154,618,457 probably benign Het
Cyp26c1 T C 19: 37,693,210 V487A probably benign Het
Dlx6 T C 6: 6,867,207 M270T probably damaging Het
Glb1 T C 9: 114,443,114 I273T probably damaging Het
Glp1r A C 17: 30,918,931 H112P probably benign Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Hcrtr1 A G 4: 130,135,763 V175A probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kif1bp A G 10: 62,563,027 probably benign Het
Mki67 G A 7: 135,697,671 T1878I probably benign Het
Ncoa6 A G 2: 155,407,476 F1303L possibly damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nutf2 T A 8: 105,876,427 probably null Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Rbm45 T C 2: 76,376,396 S251P probably damaging Het
Rnaset2b A G 17: 6,998,070 Y155C probably damaging Het
Rnf122 A G 8: 31,128,255 T92A probably damaging Het
Rnf220 A G 4: 117,489,814 S134P probably damaging Het
Shprh A T 10: 11,160,471 I351F probably benign Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Sulf1 G T 1: 12,786,515 probably benign Het
Svil T C 18: 5,049,067 Y202H probably damaging Het
Tek A G 4: 94,849,756 D681G possibly damaging Het
Vcp A T 4: 42,993,826 I102N probably damaging Het
Vmn2r25 A T 6: 123,822,860 I841N probably damaging Het
Zfp949 T C 9: 88,570,089 S571P probably damaging Het
Zkscan16 A G 4: 58,957,431 E571G possibly damaging Het
Zufsp G A 10: 33,948,964 T174I probably damaging Het
Other mutations in Tra2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02061:Tra2a APN 6 49249098 missense possibly damaging 0.66
IGL03160:Tra2a APN 6 49263864 missense possibly damaging 0.46
IGL03246:Tra2a APN 6 49249085 nonsense probably null
IGL03098:Tra2a UTSW 6 49249035 missense probably damaging 1.00
R0492:Tra2a UTSW 6 49250955 utr 3 prime probably benign
R0544:Tra2a UTSW 6 49250951 utr 3 prime probably benign
R1634:Tra2a UTSW 6 49250957 utr 3 prime probably benign
R2174:Tra2a UTSW 6 49250927 utr 3 prime probably benign
R2571:Tra2a UTSW 6 49252487 utr 3 prime probably benign
R3154:Tra2a UTSW 6 49245512 utr 3 prime probably benign
R3897:Tra2a UTSW 6 49245542 utr 3 prime probably benign
R5358:Tra2a UTSW 6 49251015 utr 3 prime probably benign
R6045:Tra2a UTSW 6 49252464 utr 3 prime probably benign
R7303:Tra2a UTSW 6 49250987 missense unknown
R7450:Tra2a UTSW 6 49250985 nonsense probably null
X0026:Tra2a UTSW 6 49252392 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- CTAAAGGTCTGAGCAGATGGTG -3'
(R):5'- GACAGTTAGCAGTATTAACAATGGG -3'

Sequencing Primer
(F):5'- GGTGAACTTTCTGTGTGAAATACAGC -3'
(R):5'- GGTGTTGCCTAACCATTTG -3'
Posted On2015-07-21