Incidental Mutation 'R4488:Homer3'
ID330596
Institutional Source Beutler Lab
Gene Symbol Homer3
Ensembl Gene ENSMUSG00000003573
Gene Namehomer scaffolding protein 3
Synonyms
MMRRC Submission 041744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R4488 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70282827-70294361 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 70290143 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000003669] [ENSMUST00000008004] [ENSMUST00000087467] [ENSMUST00000110124] [ENSMUST00000140212]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003669
AA Change: R168Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003669
Gene: ENSMUSG00000003573
AA Change: R168Q

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 285 342 2e-10 PDB
low complexity region 343 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000008004
SMART Domains Protein: ENSMUSP00000008004
Gene: ENSMUSG00000057788

DomainStartEndE-ValueType
DEXDc 21 222 1.85e-57 SMART
HELICc 262 343 2.41e-29 SMART
low complexity region 369 383 N/A INTRINSIC
low complexity region 461 470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087467
SMART Domains Protein: ENSMUSP00000084735
Gene: ENSMUSG00000003573

DomainStartEndE-ValueType
Pfam:WH1 1 107 4.2e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110124
AA Change: R168Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105751
Gene: ENSMUSG00000003573
AA Change: R168Q

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 285 342 2e-10 PDB
low complexity region 343 358 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127094
Predicted Effect probably null
Transcript: ENSMUST00000135368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135692
Predicted Effect possibly damaging
Transcript: ENSMUST00000140212
AA Change: R168Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117033
Gene: ENSMUSG00000003573
AA Change: R168Q

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 282 339 2e-10 PDB
low complexity region 340 355 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155711
Meta Mutation Damage Score 0.3504 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HOMER family of postsynaptic density scaffolding proteins that share a similar domain structure consisting of an N-terminal Enabled/vasodilator-stimulated phosphoprotein homology 1 domain which mediates protein-protein interactions, and a carboxy-terminal coiled-coil domain and two leucine zipper motifs that are involved in self-oligomerization. The encoded protein binds numerous other proteins including group I metabotropic glutamate receptors, inositol 1,4,5-trisphosphate receptors and amyloid precursor proteins and has been implicated in diverse biological functions such as neuronal signaling, T-cell activation and trafficking of amyloid beta peptides. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutants exhibit normal sensitivity to cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,003,933 Q3224L probably null Het
Alkal1 A T 1: 6,359,407 Q26L probably benign Het
Brox A G 1: 183,280,950 L280S probably benign Het
Cep41 A T 6: 30,655,689 probably benign Het
Cryz C A 3: 154,618,457 probably benign Het
Cyp26c1 T C 19: 37,693,210 V487A probably benign Het
Dlx6 T C 6: 6,867,207 M270T probably damaging Het
Glb1 T C 9: 114,443,114 I273T probably damaging Het
Glp1r A C 17: 30,918,931 H112P probably benign Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Hcrtr1 A G 4: 130,135,763 V175A probably benign Het
Kif1bp A G 10: 62,563,027 probably benign Het
Mki67 G A 7: 135,697,671 T1878I probably benign Het
Ncoa6 A G 2: 155,407,476 F1303L possibly damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nutf2 T A 8: 105,876,427 probably null Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Rbm45 T C 2: 76,376,396 S251P probably damaging Het
Rnaset2b A G 17: 6,998,070 Y155C probably damaging Het
Rnf122 A G 8: 31,128,255 T92A probably damaging Het
Rnf220 A G 4: 117,489,814 S134P probably damaging Het
Shprh A T 10: 11,160,471 I351F probably benign Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Sulf1 G T 1: 12,786,515 probably benign Het
Svil T C 18: 5,049,067 Y202H probably damaging Het
Tek A G 4: 94,849,756 D681G possibly damaging Het
Tra2a A G 6: 49,252,494 probably benign Het
Vcp A T 4: 42,993,826 I102N probably damaging Het
Vmn2r25 A T 6: 123,822,860 I841N probably damaging Het
Zfp949 T C 9: 88,570,089 S571P probably damaging Het
Zkscan16 A G 4: 58,957,431 E571G possibly damaging Het
Zufsp G A 10: 33,948,964 T174I probably damaging Het
Other mutations in Homer3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01966:Homer3 APN 8 70290157 missense probably damaging 0.96
IGL02493:Homer3 APN 8 70290071 missense probably benign 0.00
IGL03134:Homer3 UTSW 8 70286335 missense probably benign 0.00
R2436:Homer3 UTSW 8 70293056 missense possibly damaging 0.91
R3508:Homer3 UTSW 8 70291355 missense probably benign 0.06
R4391:Homer3 UTSW 8 70290143 splice site probably null
R4392:Homer3 UTSW 8 70290143 splice site probably null
R4395:Homer3 UTSW 8 70290143 splice site probably null
R4396:Homer3 UTSW 8 70290143 splice site probably null
R4397:Homer3 UTSW 8 70290143 splice site probably null
R4401:Homer3 UTSW 8 70290143 splice site probably null
R4402:Homer3 UTSW 8 70290143 splice site probably null
R4445:Homer3 UTSW 8 70290143 splice site probably null
R4446:Homer3 UTSW 8 70290143 splice site probably null
R4482:Homer3 UTSW 8 70290143 splice site probably null
R4489:Homer3 UTSW 8 70290143 splice site probably null
R4664:Homer3 UTSW 8 70290143 splice site probably null
R4666:Homer3 UTSW 8 70290143 splice site probably null
R4751:Homer3 UTSW 8 70285434 missense probably damaging 1.00
R5071:Homer3 UTSW 8 70291355 missense probably benign
R5828:Homer3 UTSW 8 70286306 missense probably benign 0.02
R6052:Homer3 UTSW 8 70291426 nonsense probably null
R6211:Homer3 UTSW 8 70285524 missense probably damaging 1.00
R6234:Homer3 UTSW 8 70291165 critical splice donor site probably null
R6895:Homer3 UTSW 8 70285305 missense probably damaging 0.99
R6914:Homer3 UTSW 8 70291551 missense probably benign 0.00
R6942:Homer3 UTSW 8 70291551 missense probably benign 0.00
R7300:Homer3 UTSW 8 70285303 start codon destroyed probably null 0.23
R7391:Homer3 UTSW 8 70289484 missense probably benign 0.00
R7553:Homer3 UTSW 8 70290124 missense probably benign 0.02
R7555:Homer3 UTSW 8 70289413 missense probably damaging 1.00
R7721:Homer3 UTSW 8 70291012 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCCCAGTGGCTTCAATCAAC -3'
(R):5'- TAGTGACAATCAAGACCCTGAC -3'

Sequencing Primer
(F):5'- CCAGTGGCTTCAATCAACTTTAC -3'
(R):5'- AATTTCTGAGTTCGAGGCCAGC -3'
Posted On2015-07-21