Incidental Mutation 'R4488:Homer3'
ID 330596
Institutional Source Beutler Lab
Gene Symbol Homer3
Ensembl Gene ENSMUSG00000003573
Gene Name homer scaffolding protein 3
Synonyms
MMRRC Submission 041744-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.200) question?
Stock # R4488 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 70735529-70747011 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 70742793 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000003669] [ENSMUST00000008004] [ENSMUST00000087467] [ENSMUST00000110124] [ENSMUST00000140212]
AlphaFold Q99JP6
Predicted Effect possibly damaging
Transcript: ENSMUST00000003669
AA Change: R168Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003669
Gene: ENSMUSG00000003573
AA Change: R168Q

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 285 342 2e-10 PDB
low complexity region 343 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000008004
SMART Domains Protein: ENSMUSP00000008004
Gene: ENSMUSG00000057788

DomainStartEndE-ValueType
DEXDc 21 222 1.85e-57 SMART
HELICc 262 343 2.41e-29 SMART
low complexity region 369 383 N/A INTRINSIC
low complexity region 461 470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087467
SMART Domains Protein: ENSMUSP00000084735
Gene: ENSMUSG00000003573

DomainStartEndE-ValueType
Pfam:WH1 1 107 4.2e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110124
AA Change: R168Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105751
Gene: ENSMUSG00000003573
AA Change: R168Q

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 285 342 2e-10 PDB
low complexity region 343 358 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127094
Predicted Effect probably null
Transcript: ENSMUST00000135368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143528
Predicted Effect possibly damaging
Transcript: ENSMUST00000140212
AA Change: R168Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117033
Gene: ENSMUSG00000003573
AA Change: R168Q

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 282 339 2e-10 PDB
low complexity region 340 355 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135692
Meta Mutation Damage Score 0.3504 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HOMER family of postsynaptic density scaffolding proteins that share a similar domain structure consisting of an N-terminal Enabled/vasodilator-stimulated phosphoprotein homology 1 domain which mediates protein-protein interactions, and a carboxy-terminal coiled-coil domain and two leucine zipper motifs that are involved in self-oligomerization. The encoded protein binds numerous other proteins including group I metabotropic glutamate receptors, inositol 1,4,5-trisphosphate receptors and amyloid precursor proteins and has been implicated in diverse biological functions such as neuronal signaling, T-cell activation and trafficking of amyloid beta peptides. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutants exhibit normal sensitivity to cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alkal1 A T 1: 6,429,631 (GRCm39) Q26L probably benign Het
Bltp1 A T 3: 37,058,082 (GRCm39) Q3224L probably null Het
Brox A G 1: 183,062,514 (GRCm39) L280S probably benign Het
Cep41 A T 6: 30,655,688 (GRCm39) probably benign Het
Cryz C A 3: 154,324,094 (GRCm39) probably benign Het
Cyp26c1 T C 19: 37,681,658 (GRCm39) V487A probably benign Het
Dlx6 T C 6: 6,867,207 (GRCm39) M270T probably damaging Het
Glb1 T C 9: 114,272,182 (GRCm39) I273T probably damaging Het
Glp1r A C 17: 31,137,905 (GRCm39) H112P probably benign Het
Grm6 T C 11: 50,750,816 (GRCm39) S660P probably damaging Het
Hao2 T A 3: 98,789,341 (GRCm39) I116F probably damaging Het
Hcrtr1 A G 4: 130,029,556 (GRCm39) V175A probably benign Het
Kifbp A G 10: 62,398,806 (GRCm39) probably benign Het
Mki67 G A 7: 135,299,400 (GRCm39) T1878I probably benign Het
Ncoa6 A G 2: 155,249,396 (GRCm39) F1303L possibly damaging Het
Ngf G A 3: 102,428,015 (GRCm39) D255N probably damaging Het
Nutf2 T A 8: 106,603,059 (GRCm39) probably null Het
Or52e7 T C 7: 104,684,510 (GRCm39) F35S probably benign Het
Rbm45 T C 2: 76,206,740 (GRCm39) S251P probably damaging Het
Rnaset2b A G 17: 7,265,469 (GRCm39) Y155C probably damaging Het
Rnf122 A G 8: 31,618,283 (GRCm39) T92A probably damaging Het
Rnf220 A G 4: 117,347,011 (GRCm39) S134P probably damaging Het
Shprh A T 10: 11,036,215 (GRCm39) I351F probably benign Het
Smchd1 T C 17: 71,714,230 (GRCm39) T878A probably benign Het
Sulf1 G T 1: 12,856,739 (GRCm39) probably benign Het
Svil T C 18: 5,049,067 (GRCm39) Y202H probably damaging Het
Tek A G 4: 94,737,993 (GRCm39) D681G possibly damaging Het
Tra2a A G 6: 49,229,428 (GRCm39) probably benign Het
Vcp A T 4: 42,993,826 (GRCm39) I102N probably damaging Het
Vmn2r25 A T 6: 123,799,819 (GRCm39) I841N probably damaging Het
Zfp949 T C 9: 88,452,142 (GRCm39) S571P probably damaging Het
Zkscan16 A G 4: 58,957,431 (GRCm39) E571G possibly damaging Het
Zup1 G A 10: 33,824,960 (GRCm39) T174I probably damaging Het
Other mutations in Homer3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01966:Homer3 APN 8 70,742,807 (GRCm39) missense probably damaging 0.96
IGL02493:Homer3 APN 8 70,742,721 (GRCm39) missense probably benign 0.00
IGL03134:Homer3 UTSW 8 70,738,985 (GRCm39) missense probably benign 0.00
R2436:Homer3 UTSW 8 70,745,706 (GRCm39) missense possibly damaging 0.91
R3508:Homer3 UTSW 8 70,744,005 (GRCm39) missense probably benign 0.06
R4391:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4392:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4395:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4396:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4397:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4401:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4402:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4445:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4446:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4482:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4489:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4664:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4666:Homer3 UTSW 8 70,742,793 (GRCm39) splice site probably null
R4751:Homer3 UTSW 8 70,738,084 (GRCm39) missense probably damaging 1.00
R5071:Homer3 UTSW 8 70,744,005 (GRCm39) missense probably benign
R5828:Homer3 UTSW 8 70,738,956 (GRCm39) missense probably benign 0.02
R6052:Homer3 UTSW 8 70,744,076 (GRCm39) nonsense probably null
R6211:Homer3 UTSW 8 70,738,174 (GRCm39) missense probably damaging 1.00
R6234:Homer3 UTSW 8 70,743,815 (GRCm39) critical splice donor site probably null
R6895:Homer3 UTSW 8 70,737,955 (GRCm39) missense probably damaging 0.99
R6914:Homer3 UTSW 8 70,744,201 (GRCm39) missense probably benign 0.00
R6942:Homer3 UTSW 8 70,744,201 (GRCm39) missense probably benign 0.00
R7300:Homer3 UTSW 8 70,737,953 (GRCm39) start codon destroyed probably null 0.23
R7391:Homer3 UTSW 8 70,742,134 (GRCm39) missense probably benign 0.00
R7553:Homer3 UTSW 8 70,742,774 (GRCm39) missense probably benign 0.02
R7555:Homer3 UTSW 8 70,742,063 (GRCm39) missense probably damaging 1.00
R7721:Homer3 UTSW 8 70,743,662 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCCCAGTGGCTTCAATCAAC -3'
(R):5'- TAGTGACAATCAAGACCCTGAC -3'

Sequencing Primer
(F):5'- CCAGTGGCTTCAATCAACTTTAC -3'
(R):5'- AATTTCTGAGTTCGAGGCCAGC -3'
Posted On 2015-07-21