Incidental Mutation 'R4488:Zfp949'
ID330598
Institutional Source Beutler Lab
Gene Symbol Zfp949
Ensembl Gene ENSMUSG00000032425
Gene Namezinc finger protein 949
Synonyms4930422I07Rik
MMRRC Submission 041744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4488 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location88548020-88571061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88570089 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 571 (S571P)
Ref Sequence ENSEMBL: ENSMUSP00000125325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160652] [ENSMUST00000161458] [ENSMUST00000162827]
Predicted Effect probably benign
Transcript: ENSMUST00000160652
Predicted Effect probably damaging
Transcript: ENSMUST00000161458
AA Change: S571P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125017
Gene: ENSMUSG00000032425
AA Change: S571P

DomainStartEndE-ValueType
KRAB 8 68 2.63e-32 SMART
ZnF_C2H2 268 290 5.99e1 SMART
ZnF_C2H2 296 318 5.5e-3 SMART
ZnF_C2H2 324 346 6.42e-4 SMART
ZnF_C2H2 352 374 2.91e-2 SMART
ZnF_C2H2 380 402 4.11e-2 SMART
ZnF_C2H2 408 430 3.63e-3 SMART
ZnF_C2H2 436 458 5.67e-5 SMART
ZnF_C2H2 464 486 7.9e-4 SMART
ZnF_C2H2 492 514 2.43e-4 SMART
ZnF_C2H2 520 542 2.95e-3 SMART
ZnF_C2H2 548 570 1.03e-2 SMART
ZnF_C2H2 576 598 1.4e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162827
AA Change: S571P

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125325
Gene: ENSMUSG00000032425
AA Change: S571P

DomainStartEndE-ValueType
KRAB 8 68 2.63e-32 SMART
ZnF_C2H2 268 290 5.99e1 SMART
ZnF_C2H2 296 318 5.5e-3 SMART
ZnF_C2H2 324 346 6.42e-4 SMART
ZnF_C2H2 352 374 2.91e-2 SMART
ZnF_C2H2 380 402 4.11e-2 SMART
ZnF_C2H2 408 430 3.63e-3 SMART
ZnF_C2H2 436 458 5.67e-5 SMART
ZnF_C2H2 464 486 7.9e-4 SMART
ZnF_C2H2 492 514 2.43e-4 SMART
ZnF_C2H2 520 542 2.95e-3 SMART
ZnF_C2H2 548 570 1.03e-2 SMART
ZnF_C2H2 576 598 1.4e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162985
SMART Domains Protein: ENSMUSP00000124007
Gene: ENSMUSG00000032425

DomainStartEndE-ValueType
KRAB 8 68 2.63e-32 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 95% (38/40)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogenesis with defects in growth, development, cell proliferation, apoptosis and turning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,003,933 Q3224L probably null Het
Alkal1 A T 1: 6,359,407 Q26L probably benign Het
Brox A G 1: 183,280,950 L280S probably benign Het
Cep41 A T 6: 30,655,689 probably benign Het
Cryz C A 3: 154,618,457 probably benign Het
Cyp26c1 T C 19: 37,693,210 V487A probably benign Het
Dlx6 T C 6: 6,867,207 M270T probably damaging Het
Glb1 T C 9: 114,443,114 I273T probably damaging Het
Glp1r A C 17: 30,918,931 H112P probably benign Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Hcrtr1 A G 4: 130,135,763 V175A probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kif1bp A G 10: 62,563,027 probably benign Het
Mki67 G A 7: 135,697,671 T1878I probably benign Het
Ncoa6 A G 2: 155,407,476 F1303L possibly damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nutf2 T A 8: 105,876,427 probably null Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Rbm45 T C 2: 76,376,396 S251P probably damaging Het
Rnaset2b A G 17: 6,998,070 Y155C probably damaging Het
Rnf122 A G 8: 31,128,255 T92A probably damaging Het
Rnf220 A G 4: 117,489,814 S134P probably damaging Het
Shprh A T 10: 11,160,471 I351F probably benign Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Sulf1 G T 1: 12,786,515 probably benign Het
Svil T C 18: 5,049,067 Y202H probably damaging Het
Tek A G 4: 94,849,756 D681G possibly damaging Het
Tra2a A G 6: 49,252,494 probably benign Het
Vcp A T 4: 42,993,826 I102N probably damaging Het
Vmn2r25 A T 6: 123,822,860 I841N probably damaging Het
Zkscan16 A G 4: 58,957,431 E571G possibly damaging Het
Zufsp G A 10: 33,948,964 T174I probably damaging Het
Other mutations in Zfp949
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03201:Zfp949 APN 9 88568664 missense probably benign 0.23
R0034:Zfp949 UTSW 9 88567640 intron probably benign
R0462:Zfp949 UTSW 9 88568734 missense possibly damaging 0.63
R1457:Zfp949 UTSW 9 88569838 missense probably damaging 1.00
R1574:Zfp949 UTSW 9 88569777 nonsense probably null
R1574:Zfp949 UTSW 9 88569777 nonsense probably null
R1878:Zfp949 UTSW 9 88569303 missense probably damaging 0.99
R1917:Zfp949 UTSW 9 88570062 missense probably damaging 0.98
R4839:Zfp949 UTSW 9 88569994 missense probably damaging 0.97
R5309:Zfp949 UTSW 9 88567183 missense possibly damaging 0.92
R5312:Zfp949 UTSW 9 88567183 missense possibly damaging 0.92
R5461:Zfp949 UTSW 9 88569484 missense probably benign 0.00
R6530:Zfp949 UTSW 9 88567287 critical splice donor site probably null
R6844:Zfp949 UTSW 9 88569411 missense possibly damaging 0.91
R7749:Zfp949 UTSW 9 88569870 missense probably damaging 1.00
R7937:Zfp949 UTSW 9 88569270 missense probably damaging 1.00
R8150:Zfp949 UTSW 9 88570000 missense probably benign
R8290:Zfp949 UTSW 9 88569240 missense probably damaging 0.98
R8349:Zfp949 UTSW 9 88567249 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- ACAAGCATCAGATAATTCACACAGGTG -3'
(R):5'- TTCTAAGGCTTAAAGGTCTATCTGGA -3'

Sequencing Primer
(F):5'- CAGGTGAAAAGCCCTATGAGTGC -3'
(R):5'- GCGAGCTTCTCCATTAAAGATCG -3'
Posted On2015-07-21