Incidental Mutation 'R4488:Glb1'
ID330599
Institutional Source Beutler Lab
Gene Symbol Glb1
Ensembl Gene ENSMUSG00000045594
Gene Namegalactosidase, beta 1
SynonymsC130097A14Rik, Bgs, Bgl-t, Bgl, Bgl-e, Bgt, Bge, Bgl-s
MMRRC Submission 041744-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4488 (G1)
Quality Score168
Status Validated
Chromosome9
Chromosomal Location114401076-114474898 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114443114 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 273 (I273T)
Ref Sequence ENSEMBL: ENSMUSP00000149937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063042] [ENSMUST00000217583]
Predicted Effect probably damaging
Transcript: ENSMUST00000063042
AA Change: I355T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055803
Gene: ENSMUSG00000045594
AA Change: I355T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_35 41 358 2.5e-129 PFAM
Pfam:Glyco_hydro_42 56 216 9.4e-15 PFAM
Pfam:BetaGal_dom4_5 531 623 4.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217583
AA Change: I273T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8569 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: This gene encodes a preproprotein that is proteolytically cleaved to yield a signal peptide and a proproptein that is subsequently processed to generate the active mature peptide. The encoded protein is a lysosomal enzyme that catalyzes the hydrolysis of terminal beta-D-galactose residues in various substrates like lactose, ganglioside GM1 and other glycoproteins. Mutations in the human gene are associated with GM1-gangliosidosis and Morquio B syndrome. Disruption of the mouse gene mirrors the symptoms of human gangliosidosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit progressive spastic diplegia, emaciation, and accumulation of ganglioside GM1 and asialo GM1 in brain tissue. Mutants die at 7-10 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,003,933 Q3224L probably null Het
Alkal1 A T 1: 6,359,407 Q26L probably benign Het
Brox A G 1: 183,280,950 L280S probably benign Het
Cep41 A T 6: 30,655,689 probably benign Het
Cryz C A 3: 154,618,457 probably benign Het
Cyp26c1 T C 19: 37,693,210 V487A probably benign Het
Dlx6 T C 6: 6,867,207 M270T probably damaging Het
Glp1r A C 17: 30,918,931 H112P probably benign Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Hcrtr1 A G 4: 130,135,763 V175A probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kif1bp A G 10: 62,563,027 probably benign Het
Mki67 G A 7: 135,697,671 T1878I probably benign Het
Ncoa6 A G 2: 155,407,476 F1303L possibly damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nutf2 T A 8: 105,876,427 probably null Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Rbm45 T C 2: 76,376,396 S251P probably damaging Het
Rnaset2b A G 17: 6,998,070 Y155C probably damaging Het
Rnf122 A G 8: 31,128,255 T92A probably damaging Het
Rnf220 A G 4: 117,489,814 S134P probably damaging Het
Shprh A T 10: 11,160,471 I351F probably benign Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Sulf1 G T 1: 12,786,515 probably benign Het
Svil T C 18: 5,049,067 Y202H probably damaging Het
Tek A G 4: 94,849,756 D681G possibly damaging Het
Tra2a A G 6: 49,252,494 probably benign Het
Vcp A T 4: 42,993,826 I102N probably damaging Het
Vmn2r25 A T 6: 123,822,860 I841N probably damaging Het
Zfp949 T C 9: 88,570,089 S571P probably damaging Het
Zkscan16 A G 4: 58,957,431 E571G possibly damaging Het
Zufsp G A 10: 33,948,964 T174I probably damaging Het
Other mutations in Glb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Glb1 APN 9 114450677 splice site probably benign
IGL01649:Glb1 APN 9 114423948 missense probably damaging 1.00
IGL01720:Glb1 APN 9 114420505 critical splice donor site probably null
IGL02199:Glb1 APN 9 114473947 missense probably benign 0.06
IGL02613:Glb1 APN 9 114464062 missense possibly damaging 0.91
IGL03392:Glb1 APN 9 114430321 missense probably damaging 1.00
R0463:Glb1 UTSW 9 114421744 frame shift probably null
R0518:Glb1 UTSW 9 114421744 frame shift probably null
R0519:Glb1 UTSW 9 114421744 frame shift probably null
R0520:Glb1 UTSW 9 114421744 frame shift probably null
R1387:Glb1 UTSW 9 114420363 missense probably damaging 1.00
R1499:Glb1 UTSW 9 114417103 missense probably benign 0.04
R1898:Glb1 UTSW 9 114424035 missense probably damaging 1.00
R2143:Glb1 UTSW 9 114437824 missense probably damaging 1.00
R2145:Glb1 UTSW 9 114464165 missense probably benign 0.00
R2146:Glb1 UTSW 9 114450648 missense probably damaging 1.00
R2148:Glb1 UTSW 9 114450648 missense probably damaging 1.00
R2149:Glb1 UTSW 9 114450648 missense probably damaging 1.00
R2150:Glb1 UTSW 9 114450648 missense probably damaging 1.00
R2170:Glb1 UTSW 9 114473805 critical splice acceptor site probably benign
R2259:Glb1 UTSW 9 114443032 nonsense probably null
R2401:Glb1 UTSW 9 114454257 missense possibly damaging 0.81
R3980:Glb1 UTSW 9 114417064 missense probably damaging 0.97
R4696:Glb1 UTSW 9 114464152 missense probably benign
R5349:Glb1 UTSW 9 114434461 critical splice donor site probably null
R6045:Glb1 UTSW 9 114437942 missense probably damaging 1.00
R6448:Glb1 UTSW 9 114434431 missense probably damaging 0.99
R7308:Glb1 UTSW 9 114473863 missense probably damaging 0.98
R7327:Glb1 UTSW 9 114417058 missense probably benign 0.00
R7492:Glb1 UTSW 9 114473949 missense probably damaging 1.00
R8087:Glb1 UTSW 9 114430415 missense probably damaging 1.00
R8181:Glb1 UTSW 9 114430361 missense probably damaging 1.00
X0052:Glb1 UTSW 9 114473805 critical splice acceptor site probably benign
Z1177:Glb1 UTSW 9 114420422 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTTGACCAGCTGTAGAAATGC -3'
(R):5'- GCCTTTGCTGATAAACTCATGGG -3'

Sequencing Primer
(F):5'- CTTGACCAGCTGTAGAAATGCTATCC -3'
(R):5'- GCTGATAAACTCATGGGGTCTTCC -3'
Posted On2015-07-21