Mutagenetix > Incidental Mutations

Incidental Mutation 'R0052:Mmd'

33060

Institutional Source

Beutler Lab

Gene Symbol

Mmd

Ensembl Gene

ENSMUSG00000003948

Gene Name

monocyte to macrophage differentiation-associated

Synonyms

1200017E07Rik, 1810073C06Rik

MMRRC Submission

038346-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.104) question?

Stock #

R0052 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

90249456-90278589 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 90259998 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000103519 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004050] [ENSMUST00000107887]

Predicted Effect

probably benign
Transcript: ENSMUST00000004050

SMART Domains

Protein: ENSMUSP00000004050
Gene: ENSMUSG00000003948

Domain	Start	End	E-Value	Type
low complexity region	1	14	N/A	INTRINSIC
Pfam:HlyIII	24	220	9.9e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107887

SMART Domains

Protein: ENSMUSP00000103519
Gene: ENSMUSG00000003948

Domain	Start	End	E-Value	Type
low complexity region	1	14	N/A	INTRINSIC
Pfam:HlyIII	23	179	8.8e-35	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210131

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211334

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.2%

Validation Efficiency

97% (65/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is expressed by in vitro differentiated macrophages but not freshly isolated monocytes. Although sequence analysis identifies seven potential transmembrane domains, this protein has little homology to G-protein receptors and it has not been positively identified as a receptor. A suggested alternative function is that of an ion channel protein in maturing macrophages. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apba1	T	C	19: 23,915,951	S438P	possibly damaging	Het
Atp2a1	A	G	7: 126,457,897		probably benign	Het
Axin2	T	C	11: 108,949,270	Y735H	probably damaging	Het
Bicd2	T	A	13: 49,375,314	L184Q	probably damaging	Het
Bub1	G	A	2: 127,809,039	T618I	probably benign	Het
Catsperg2	A	G	7: 29,725,020		probably benign	Het
Ccdc73	T	A	2: 104,929,570		probably benign	Het
Crybg3	A	T	16: 59,565,656		probably benign	Het
Dsp	A	G	13: 38,197,364	D2096G	possibly damaging	Het
Eef2	C	CN	10: 81,178,768		probably null	Het
Elp3	A	G	14: 65,531,526	*548Q	probably null	Het
Eno4	A	G	19: 58,968,553	D357G	probably damaging	Het
Fam214a	A	G	9: 75,018,983		probably benign	Het
Fcrls	A	T	3: 87,256,778	I348N	possibly damaging	Het
Fgl2	A	T	5: 21,375,349	S230C	probably damaging	Het
Ginm1	T	A	10: 7,779,306	E57D	possibly damaging	Het
Gtf3c1	A	T	7: 125,667,971		probably null	Het
Herc1	G	T	9: 66,400,156	G1044V	probably damaging	Het
Hmcn1	G	A	1: 150,677,406	T2511M	probably damaging	Het
Iba57	C	T	11: 59,158,901	A207T	probably benign	Het
Itga9	T	A	9: 118,636,549	I157N	probably damaging	Het
Kalrn	A	G	16: 34,357,171	L208P	probably damaging	Het
Kcnj10	A	G	1: 172,368,924	T2A	probably benign	Het
Kdm1b	T	A	13: 47,064,117	C351S	probably damaging	Het
Kif21a	T	C	15: 90,970,857	E700G	probably damaging	Het
Mocs3	C	T	2: 168,231,682	P350S	probably benign	Het
Morn3	T	C	5: 123,046,663	Y38C	probably damaging	Het
Nacc1	A	T	8: 84,676,225	V313D	probably benign	Het
Nbeal1	T	A	1: 60,228,612		probably benign	Het
Neb	T	C	2: 52,273,980	K1989E	possibly damaging	Het
Nlrp3	C	T	11: 59,565,128	R917*	probably null	Het
Nlrp4b	T	A	7: 10,725,962	Y463*	probably null	Het
Perm1	A	T	4: 156,218,115	D372V	probably damaging	Het
Phf3	T	C	1: 30,808,767	T1232A	probably damaging	Het
Phldb3	G	A	7: 24,612,579	R106Q	probably benign	Het
Pld4	T	A	12: 112,767,857	F386I	probably benign	Het
Prex2	T	A	1: 11,160,156	L802Q	probably damaging	Het
Psd3	A	G	8: 67,882,979		probably null	Het
Ralgds	T	A	2: 28,544,388		probably null	Het
Rmdn2	A	G	17: 79,650,331	E16G	probably damaging	Het
Rnf111	A	T	9: 70,476,389	S87R	probably benign	Het
Slc4a4	A	C	5: 89,156,336	H502P	possibly damaging	Het
Slc9c1	A	G	16: 45,606,856		probably benign	Het
Slco3a1	A	T	7: 74,504,326	I166N	probably benign	Het
Snx5	A	T	2: 144,259,192		probably null	Het
Srgap1	T	C	10: 121,800,827	D741G	possibly damaging	Het
St8sia2	G	T	7: 73,943,290	Y339*	probably null	Het
St8sia2	A	T	7: 73,971,952	W86R	probably damaging	Het
Stk33	A	G	7: 109,279,669	L491P	possibly damaging	Het
Sult2a7	T	C	7: 14,465,208	Y298C	probably damaging	Het
Tdo2	T	A	3: 81,967,025	N210I	probably benign	Het
Thada	A	T	17: 84,455,158	N104K	probably damaging	Het
Timm8b	A	T	9: 50,605,030	D61V	possibly damaging	Het
Tshz1	G	A	18: 84,014,945	T446I	possibly damaging	Het
Ubap2l	T	C	3: 90,038,928	N123S	possibly damaging	Het
Vmn1r48	T	C	6: 90,036,264	E193G	possibly damaging	Het
Vmn1r69	C	T	7: 10,580,400	V135I	probably benign	Het
Vmn2r103	G	T	17: 19,811,641	G559V	probably benign	Het
Vmn2r26	T	A	6: 124,062,033	*856R	probably null	Het
Vmn2r88	A	G	14: 51,418,700	I798V	possibly damaging	Het
Vsir	C	T	10: 60,358,082	A108V	probably benign	Het
Zfp14	G	T	7: 30,038,328	Q411K	probably damaging	Het
Zfp236	A	T	18: 82,639,332	M762K	probably damaging	Het
Zfp462	G	A	4: 55,011,762	G1243S	probably benign	Het

Other mutations in Mmd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Mmd	APN	11	90264534	missense	probably damaging	1.00
IGL01300:Mmd	APN	11	90249711	start codon destroyed	probably null
IGL03412:Mmd	APN	11	90257603	critical splice donor site	probably null
R0052:Mmd	UTSW	11	90259998	splice site	probably benign
R1342:Mmd	UTSW	11	90276850	missense	probably benign	0.03
R3084:Mmd	UTSW	11	90266085	missense	probably damaging	1.00
R6969:Mmd	UTSW	11	90257536	missense	probably damaging	1.00
R7079:Mmd	UTSW	11	90267499	splice site	probably null
R7626:Mmd	UTSW	11	90257552	missense	probably damaging	0.98
R7638:Mmd	UTSW	11	90276757	missense	possibly damaging	0.80
R7734:Mmd	UTSW	11	90276753	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACTGTTGATCCCGCAGACACC -3'
(R):5'- AGGCTGCAAAGTTCAATGTCCCTC -3'

Sequencing Primer
(F):5'- AGACACCAGGGTGCTTGC -3'
(R):5'- TAGTGCCCCTGGTGTACAAG -3'

Posted On

2013-05-09