Incidental Mutation 'R4488:Grm6'
ID330604
Institutional Source Beutler Lab
Gene Symbol Grm6
Ensembl Gene ENSMUSG00000000617
Gene Nameglutamate receptor, metabotropic 6
Synonymsnerg1, nob2, mGluR6, nob3
MMRRC Submission 041744-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4488 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location50850685-50866208 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50859989 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 660 (S660P)
Ref Sequence ENSEMBL: ENSMUSP00000130728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000631] [ENSMUST00000171427]
Predicted Effect probably damaging
Transcript: ENSMUST00000000631
AA Change: S660P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000000631
Gene: ENSMUSG00000000617
AA Change: S660P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 61 471 4.1e-101 PFAM
Pfam:Peripla_BP_6 132 475 1.7e-11 PFAM
Pfam:NCD3G 508 558 5.3e-16 PFAM
low complexity region 575 587 N/A INTRINSIC
Pfam:7tm_3 589 837 7.2e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126890
Predicted Effect probably damaging
Transcript: ENSMUST00000171427
AA Change: S660P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130728
Gene: ENSMUSG00000000617
AA Change: S660P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 61 471 2.5e-106 PFAM
Pfam:Peripla_BP_6 132 338 6.2e-10 PFAM
Pfam:NCD3G 508 558 4e-13 PFAM
low complexity region 575 587 N/A INTRINSIC
Pfam:7tm_3 591 836 1.4e-56 PFAM
Meta Mutation Damage Score 0.5385 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice show loss of ON responses without significant alteration of OFF responses in visual transmission or changes in visual behavioral responses. ENU-induced mutant mice have an ERG that lacks the rod b-wave and scotopic threshold response, while the cone ERG is of large amplitude. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,003,933 Q3224L probably null Het
Alkal1 A T 1: 6,359,407 Q26L probably benign Het
Brox A G 1: 183,280,950 L280S probably benign Het
Cep41 A T 6: 30,655,689 probably benign Het
Cryz C A 3: 154,618,457 probably benign Het
Cyp26c1 T C 19: 37,693,210 V487A probably benign Het
Dlx6 T C 6: 6,867,207 M270T probably damaging Het
Glb1 T C 9: 114,443,114 I273T probably damaging Het
Glp1r A C 17: 30,918,931 H112P probably benign Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Hcrtr1 A G 4: 130,135,763 V175A probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kif1bp A G 10: 62,563,027 probably benign Het
Mki67 G A 7: 135,697,671 T1878I probably benign Het
Ncoa6 A G 2: 155,407,476 F1303L possibly damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nutf2 T A 8: 105,876,427 probably null Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Rbm45 T C 2: 76,376,396 S251P probably damaging Het
Rnaset2b A G 17: 6,998,070 Y155C probably damaging Het
Rnf122 A G 8: 31,128,255 T92A probably damaging Het
Rnf220 A G 4: 117,489,814 S134P probably damaging Het
Shprh A T 10: 11,160,471 I351F probably benign Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Sulf1 G T 1: 12,786,515 probably benign Het
Svil T C 18: 5,049,067 Y202H probably damaging Het
Tek A G 4: 94,849,756 D681G possibly damaging Het
Tra2a A G 6: 49,252,494 probably benign Het
Vcp A T 4: 42,993,826 I102N probably damaging Het
Vmn2r25 A T 6: 123,822,860 I841N probably damaging Het
Zfp949 T C 9: 88,570,089 S571P probably damaging Het
Zkscan16 A G 4: 58,957,431 E571G possibly damaging Het
Zufsp G A 10: 33,948,964 T174I probably damaging Het
Other mutations in Grm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Grm6 APN 11 50863297 splice site probably benign
IGL01305:Grm6 APN 11 50859519 missense probably benign 0.27
IGL02121:Grm6 APN 11 50859656 missense probably damaging 1.00
IGL02413:Grm6 APN 11 50859939 missense probably damaging 0.99
ANU22:Grm6 UTSW 11 50859519 missense probably benign 0.27
R0089:Grm6 UTSW 11 50859965 missense probably damaging 1.00
R0135:Grm6 UTSW 11 50853223 missense probably damaging 0.99
R0147:Grm6 UTSW 11 50859317 missense possibly damaging 0.89
R1498:Grm6 UTSW 11 50857256 missense probably damaging 1.00
R1577:Grm6 UTSW 11 50863145 missense probably damaging 1.00
R1666:Grm6 UTSW 11 50859884 missense probably damaging 1.00
R2923:Grm6 UTSW 11 50864521 missense probably damaging 1.00
R4060:Grm6 UTSW 11 50853224 missense probably damaging 1.00
R4486:Grm6 UTSW 11 50859989 missense probably damaging 0.99
R4489:Grm6 UTSW 11 50859989 missense probably damaging 0.99
R4646:Grm6 UTSW 11 50857206 missense probably benign 0.03
R4701:Grm6 UTSW 11 50863010 missense probably damaging 1.00
R4785:Grm6 UTSW 11 50857277 missense probably benign 0.00
R4860:Grm6 UTSW 11 50864612 missense probably benign 0.31
R5603:Grm6 UTSW 11 50856959 missense probably damaging 1.00
R6104:Grm6 UTSW 11 50859317 missense possibly damaging 0.89
R6746:Grm6 UTSW 11 50856963 missense probably damaging 1.00
R6791:Grm6 UTSW 11 50859774 missense possibly damaging 0.74
R6802:Grm6 UTSW 11 50853389 missense probably benign 0.24
R6856:Grm6 UTSW 11 50859825 missense probably damaging 1.00
R7102:Grm6 UTSW 11 50862977 missense possibly damaging 0.87
R7221:Grm6 UTSW 11 50863043 missense probably damaging 0.97
R7727:Grm6 UTSW 11 50851542 missense probably benign 0.02
R7783:Grm6 UTSW 11 50863082 missense probably damaging 1.00
R7876:Grm6 UTSW 11 50859630 missense probably damaging 1.00
R8006:Grm6 UTSW 11 50864657 makesense probably null
X0025:Grm6 UTSW 11 50863095 missense probably damaging 1.00
Z1176:Grm6 UTSW 11 50859537 missense probably benign 0.43
Z1177:Grm6 UTSW 11 50851262 missense probably benign 0.40
Z1177:Grm6 UTSW 11 50851500 missense probably benign 0.00
Z1177:Grm6 UTSW 11 50859867 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAACTATCATTGCTACCTTCATGC -3'
(R):5'- TCTCCGAGTTTTAAGGCGAAG -3'

Sequencing Primer
(F):5'- TTGCTACCTTCATGCGACACAAC -3'
(R):5'- TTTAAGGCGAAGGACTCTATGCACC -3'
Posted On2015-07-21