Incidental Mutation 'R4488:Rnaset2b'
ID330606
Institutional Source Beutler Lab
Gene Symbol Rnaset2b
Ensembl Gene ENSMUSG00000094724
Gene Nameribonuclease T2B
Synonyms
MMRRC Submission 041744-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4488 (G1)
Quality Score221
Status Not validated
Chromosome17
Chromosomal Location6970634-7011299 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6998070 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 155 (Y155C)
Ref Sequence ENSEMBL: ENSMUSP00000156329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089119] [ENSMUST00000179728] [ENSMUST00000231550] [ENSMUST00000232245] [ENSMUST00000232304]
Predicted Effect probably damaging
Transcript: ENSMUST00000089119
AA Change: Y251C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086519
Gene: ENSMUSG00000094724
AA Change: Y251C

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Ribonuclease_T2 39 219 3.1e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179728
AA Change: Y251C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137303
Gene: ENSMUSG00000094724
AA Change: Y251C

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Ribonuclease_T2 41 217 9.3e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000231550
AA Change: Y251C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232106
Predicted Effect probably damaging
Transcript: ENSMUST00000232245
AA Change: Y161C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232304
AA Change: Y155C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 95% (38/40)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,003,933 Q3224L probably null Het
Alkal1 A T 1: 6,359,407 Q26L probably benign Het
Brox A G 1: 183,280,950 L280S probably benign Het
Cep41 A T 6: 30,655,689 probably benign Het
Cryz C A 3: 154,618,457 probably benign Het
Cyp26c1 T C 19: 37,693,210 V487A probably benign Het
Dlx6 T C 6: 6,867,207 M270T probably damaging Het
Glb1 T C 9: 114,443,114 I273T probably damaging Het
Glp1r A C 17: 30,918,931 H112P probably benign Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Hcrtr1 A G 4: 130,135,763 V175A probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kif1bp A G 10: 62,563,027 probably benign Het
Mki67 G A 7: 135,697,671 T1878I probably benign Het
Ncoa6 A G 2: 155,407,476 F1303L possibly damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nutf2 T A 8: 105,876,427 probably null Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Rbm45 T C 2: 76,376,396 S251P probably damaging Het
Rnf122 A G 8: 31,128,255 T92A probably damaging Het
Rnf220 A G 4: 117,489,814 S134P probably damaging Het
Shprh A T 10: 11,160,471 I351F probably benign Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Sulf1 G T 1: 12,786,515 probably benign Het
Svil T C 18: 5,049,067 Y202H probably damaging Het
Tek A G 4: 94,849,756 D681G possibly damaging Het
Tra2a A G 6: 49,252,494 probably benign Het
Vcp A T 4: 42,993,826 I102N probably damaging Het
Vmn2r25 A T 6: 123,822,860 I841N probably damaging Het
Zfp949 T C 9: 88,570,089 S571P probably damaging Het
Zkscan16 A G 4: 58,957,431 E571G possibly damaging Het
Zufsp G A 10: 33,948,964 T174I probably damaging Het
Other mutations in Rnaset2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02428:Rnaset2b APN 17 6981169 critical splice donor site probably null
R1209:Rnaset2b UTSW 17 6979076 missense probably benign 0.00
R1238:Rnaset2b UTSW 17 6988770 missense probably damaging 1.00
R1753:Rnaset2b UTSW 17 6981107 critical splice acceptor site probably null
R1987:Rnaset2b UTSW 17 6996477 missense probably benign 0.06
R4810:Rnaset2b UTSW 17 6991768 missense probably benign 0.00
R6081:Rnaset2b UTSW 17 6988794 critical splice donor site probably null
R6362:Rnaset2b UTSW 17 6991694 missense probably benign
R7312:Rnaset2b UTSW 17 6998028 missense probably benign 0.14
R7319:Rnaset2b UTSW 17 6991767 missense probably benign 0.43
R7535:Rnaset2b UTSW 17 6991739 missense possibly damaging 0.92
Z1176:Rnaset2b UTSW 17 6991786 missense possibly damaging 0.61
Z1177:Rnaset2b UTSW 17 6985091 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATAACAACCCAGGGCTCC -3'
(R):5'- GCAGGACCTACTAATCAGAGCAG -3'

Sequencing Primer
(F):5'- AGGGCTCCTGAATTCTGACTTGTC -3'
(R):5'- GAGCAGACAAAAACCAACTCCTTC -3'
Posted On2015-07-21