Incidental Mutation 'R4488:Cyp26c1'
ID330610
Institutional Source Beutler Lab
Gene Symbol Cyp26c1
Ensembl Gene ENSMUSG00000062432
Gene Namecytochrome P450, family 26, subfamily c, polypeptide 1
SynonymsEG546726
MMRRC Submission 041744-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4488 (G1)
Quality Score172
Status Validated
Chromosome19
Chromosomal Location37685581-37693398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37693210 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 487 (V487A)
Ref Sequence ENSEMBL: ENSMUSP00000073105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025946] [ENSMUST00000073391]
Predicted Effect probably benign
Transcript: ENSMUST00000025946
SMART Domains Protein: ENSMUSP00000025946
Gene: ENSMUSG00000024987

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:p450 45 487 2.4e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073391
AA Change: V487A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073105
Gene: ENSMUSG00000062432
AA Change: V487A

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 50 499 6.4e-54 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 95% (38/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This enzyme is involved in the catabolism of all-trans- and 9-cis-retinoic acid, and thus contributes to the regulation of retinoic acid levels in cells and tissues. This gene is adjacent to a related gene on chromosome 10q23.33. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and exhibit normal CNS development with no apparent anatomical defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 37,003,933 Q3224L probably null Het
Alkal1 A T 1: 6,359,407 Q26L probably benign Het
Brox A G 1: 183,280,950 L280S probably benign Het
Cep41 A T 6: 30,655,689 probably benign Het
Cryz C A 3: 154,618,457 probably benign Het
Dlx6 T C 6: 6,867,207 M270T probably damaging Het
Glb1 T C 9: 114,443,114 I273T probably damaging Het
Glp1r A C 17: 30,918,931 H112P probably benign Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hao2 T A 3: 98,882,025 I116F probably damaging Het
Hcrtr1 A G 4: 130,135,763 V175A probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kif1bp A G 10: 62,563,027 probably benign Het
Mki67 G A 7: 135,697,671 T1878I probably benign Het
Ncoa6 A G 2: 155,407,476 F1303L possibly damaging Het
Ngf G A 3: 102,520,699 D255N probably damaging Het
Nutf2 T A 8: 105,876,427 probably null Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Rbm45 T C 2: 76,376,396 S251P probably damaging Het
Rnaset2b A G 17: 6,998,070 Y155C probably damaging Het
Rnf122 A G 8: 31,128,255 T92A probably damaging Het
Rnf220 A G 4: 117,489,814 S134P probably damaging Het
Shprh A T 10: 11,160,471 I351F probably benign Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Sulf1 G T 1: 12,786,515 probably benign Het
Svil T C 18: 5,049,067 Y202H probably damaging Het
Tek A G 4: 94,849,756 D681G possibly damaging Het
Tra2a A G 6: 49,252,494 probably benign Het
Vcp A T 4: 42,993,826 I102N probably damaging Het
Vmn2r25 A T 6: 123,822,860 I841N probably damaging Het
Zfp949 T C 9: 88,570,089 S571P probably damaging Het
Zkscan16 A G 4: 58,957,431 E571G possibly damaging Het
Zufsp G A 10: 33,948,964 T174I probably damaging Het
Other mutations in Cyp26c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:Cyp26c1 APN 19 37688923 missense probably damaging 1.00
IGL02008:Cyp26c1 APN 19 37688924 missense probably damaging 1.00
IGL02713:Cyp26c1 APN 19 37693219 missense probably damaging 1.00
IGL02836:Cyp26c1 APN 19 37687156 missense probably benign 0.00
R0114:Cyp26c1 UTSW 19 37686633 missense probably benign 0.24
R0671:Cyp26c1 UTSW 19 37686561 missense probably damaging 1.00
R1544:Cyp26c1 UTSW 19 37690945 missense probably benign 0.03
R1959:Cyp26c1 UTSW 19 37687377 missense probably damaging 0.99
R1961:Cyp26c1 UTSW 19 37687377 missense probably damaging 0.99
R4393:Cyp26c1 UTSW 19 37686657 missense probably damaging 1.00
R4532:Cyp26c1 UTSW 19 37685779 missense probably damaging 1.00
R4687:Cyp26c1 UTSW 19 37692937 missense probably damaging 1.00
R6302:Cyp26c1 UTSW 19 37686488 missense probably damaging 1.00
R7334:Cyp26c1 UTSW 19 37688875 missense probably benign
R7634:Cyp26c1 UTSW 19 37692999 missense probably damaging 1.00
R8375:Cyp26c1 UTSW 19 37687212 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- ATGAGACAGCCGCAGTGTAC -3'
(R):5'- AGGACCTAGGGCTCTGAAGATTG -3'

Sequencing Primer
(F):5'- CTTCGATCCGGAGCGCTTTG -3'
(R):5'- GCTCTGAAGATTGGCCGG -3'
Posted On2015-07-21