Incidental Mutation 'R4489:Rgs21'
ID330615
Institutional Source Beutler Lab
Gene Symbol Rgs21
Ensembl Gene ENSMUSG00000098509
Gene Nameregulator of G-protein signalling 21
SynonymsEG624910
MMRRC Submission 041745-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R4489 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location144516648-144567667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144519875 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 92 (T92A)
Ref Sequence ENSEMBL: ENSMUSP00000139265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000184189]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184008
Predicted Effect possibly damaging
Transcript: ENSMUST00000184189
AA Change: T92A

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139265
Gene: ENSMUSG00000098509
AA Change: T92A

DomainStartEndE-ValueType
RGS 21 137 2.84e-50 SMART
Meta Mutation Damage Score 0.5216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 94% (50/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Regulator of G protein signaling (RGS) proteins are regulatory and structural components of G protein-coupled receptor complexes. RGS proteins are GTPase-activating proteins for Gi (see GNAI1; MIM 139310) and Gq (see GNAQ; MIM 600998) class G-alpha proteins. They accelerate transit through the cycle of GTP binding and hydrolysis and thereby accelerate signaling kinetics and termination.[supplied by OMIM, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,220,702 Y250H probably benign Het
4932438A13Rik A T 3: 37,003,933 Q3224L probably null Het
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Ank3 C T 10: 69,898,256 A754V probably damaging Het
Ano1 T C 7: 144,611,742 N582S probably benign Het
Arnt2 T A 7: 84,275,345 T425S probably benign Het
Cand2 A G 6: 115,789,466 D344G probably damaging Het
Clta T G 4: 44,032,417 F198V probably damaging Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Csmd2 G A 4: 128,381,945 V826M possibly damaging Het
Dnah11 C T 12: 117,916,896 V3830I probably benign Het
Fhl4 T C 10: 85,098,455 D154G possibly damaging Het
Gbp4 T A 5: 105,121,907 T352S probably damaging Het
Gigyf2 A G 1: 87,440,826 D1076G probably damaging Het
Gm21370 T A 13: 120,026,842 Y57F probably benign Het
Gm6489 A G 1: 31,287,239 noncoding transcript Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hectd4 T G 5: 121,286,257 I660R possibly damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Htr1b A T 9: 81,631,539 D338E probably benign Het
Kif1bp A G 10: 62,563,027 probably benign Het
Lrp1b T C 2: 40,661,489 probably benign Het
Lzts1 T A 8: 69,135,695 K536N possibly damaging Het
Mrpl22 T A 11: 58,173,102 N49K probably benign Het
Mzt1 T C 14: 99,036,490 *42W probably null Het
Nkx3-2 T G 5: 41,761,961 Q228P probably damaging Het
Nufip2 T G 11: 77,686,229 M1R probably null Het
Obscn G A 11: 59,031,591 T5921M possibly damaging Het
Olfr1221 T C 2: 89,111,572 probably null Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Pcdha11 C A 18: 37,006,916 Q533K possibly damaging Het
Pgm5 T C 19: 24,816,445 E285G probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rgsl1 T A 1: 153,827,536 Y123F probably benign Het
Rnf13 A C 3: 57,820,589 K230T probably damaging Het
Sgf29 T C 7: 126,663,938 S29P possibly damaging Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Specc1 T G 11: 62,151,827 probably null Het
Tg A T 15: 66,707,942 Q1532L probably damaging Het
Timm44 A C 8: 4,266,654 S297A possibly damaging Het
Txndc9 G T 1: 37,995,790 S11* probably null Het
Uggt1 C T 1: 36,146,668 W1478* probably null Het
Washc3 T C 10: 88,216,031 V87A probably benign Het
Xlr5b T C X: 73,157,898 probably null Het
Other mutations in Rgs21
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5666:Rgs21 UTSW 1 144536942 missense probably benign 0.43
R5670:Rgs21 UTSW 1 144536942 missense probably benign 0.43
R6164:Rgs21 UTSW 1 144541297 missense probably benign 0.04
R6435:Rgs21 UTSW 1 144519827 missense probably damaging 1.00
R7664:Rgs21 UTSW 1 144541249 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCAGCCATCTTTTATGATTTCC -3'
(R):5'- AAGGCCAGCTTTAACAGTTTCC -3'

Sequencing Primer
(F):5'- AGCCATCTTTTATGATTTCCAACCTG -3'
(R):5'- ACAGTTTCCTATCAATACCAATCCTC -3'
Posted On2015-07-21