Incidental Mutation 'R4489:Olfr1221'
ID330619
Institutional Source Beutler Lab
Gene Symbol Olfr1221
Ensembl Gene ENSMUSG00000075102
Gene Nameolfactory receptor 1221
SynonymsGA_x6K02T2Q125-50591144-50590209, MOR233-3
MMRRC Submission 041745-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R4489 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89109086-89117283 bp(-) (GRCm38)
Type of Mutationunclassified (3 bp from exon)
DNA Base Change (assembly) T to C at 89111572 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099795] [ENSMUST00000099795] [ENSMUST00000099806] [ENSMUST00000143255] [ENSMUST00000213288] [ENSMUST00000213404] [ENSMUST00000217635]
Predicted Effect probably null
Transcript: ENSMUST00000099795
SMART Domains Protein: ENSMUSP00000097383
Gene: ENSMUSG00000075102

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 5.6e-48 PFAM
Pfam:7tm_1 39 302 3.6e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000099795
SMART Domains Protein: ENSMUSP00000097383
Gene: ENSMUSG00000075102

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 5.6e-48 PFAM
Pfam:7tm_1 39 302 3.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099806
SMART Domains Protein: ENSMUSP00000097394
Gene: ENSMUSG00000101480

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7tm_1 39 286 3.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143255
Predicted Effect probably benign
Transcript: ENSMUST00000213288
Predicted Effect probably benign
Transcript: ENSMUST00000213404
Predicted Effect probably benign
Transcript: ENSMUST00000217635
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 94% (50/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,220,702 Y250H probably benign Het
4932438A13Rik A T 3: 37,003,933 Q3224L probably null Het
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Ank3 C T 10: 69,898,256 A754V probably damaging Het
Ano1 T C 7: 144,611,742 N582S probably benign Het
Arnt2 T A 7: 84,275,345 T425S probably benign Het
Cand2 A G 6: 115,789,466 D344G probably damaging Het
Clta T G 4: 44,032,417 F198V probably damaging Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Csmd2 G A 4: 128,381,945 V826M possibly damaging Het
Dnah11 C T 12: 117,916,896 V3830I probably benign Het
Fhl4 T C 10: 85,098,455 D154G possibly damaging Het
Gbp4 T A 5: 105,121,907 T352S probably damaging Het
Gigyf2 A G 1: 87,440,826 D1076G probably damaging Het
Gm21370 T A 13: 120,026,842 Y57F probably benign Het
Gm6489 A G 1: 31,287,239 noncoding transcript Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hectd4 T G 5: 121,286,257 I660R possibly damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Htr1b A T 9: 81,631,539 D338E probably benign Het
Kif1bp A G 10: 62,563,027 probably benign Het
Lrp1b T C 2: 40,661,489 probably benign Het
Lzts1 T A 8: 69,135,695 K536N possibly damaging Het
Mrpl22 T A 11: 58,173,102 N49K probably benign Het
Mzt1 T C 14: 99,036,490 *42W probably null Het
Nkx3-2 T G 5: 41,761,961 Q228P probably damaging Het
Nufip2 T G 11: 77,686,229 M1R probably null Het
Obscn G A 11: 59,031,591 T5921M possibly damaging Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Pcdha11 C A 18: 37,006,916 Q533K possibly damaging Het
Pgm5 T C 19: 24,816,445 E285G probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rgs21 T C 1: 144,519,875 T92A possibly damaging Het
Rgsl1 T A 1: 153,827,536 Y123F probably benign Het
Rnf13 A C 3: 57,820,589 K230T probably damaging Het
Sgf29 T C 7: 126,663,938 S29P possibly damaging Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Specc1 T G 11: 62,151,827 probably null Het
Tg A T 15: 66,707,942 Q1532L probably damaging Het
Timm44 A C 8: 4,266,654 S297A possibly damaging Het
Txndc9 G T 1: 37,995,790 S11* probably null Het
Uggt1 C T 1: 36,146,668 W1478* probably null Het
Washc3 T C 10: 88,216,031 V87A probably benign Het
Xlr5b T C X: 73,157,898 probably null Het
Other mutations in Olfr1221
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Olfr1221 APN 2 89111679 missense probably benign 0.19
IGL01965:Olfr1221 APN 2 89112191 missense probably benign 0.37
IGL02645:Olfr1221 APN 2 89111619 missense probably benign 0.00
PIT4354001:Olfr1221 UTSW 2 89112486 nonsense probably null
R0124:Olfr1221 UTSW 2 89111744 missense possibly damaging 0.56
R0940:Olfr1221 UTSW 2 89112075 missense probably benign
R3689:Olfr1221 UTSW 2 89112042 missense possibly damaging 0.85
R4706:Olfr1221 UTSW 2 89112232 missense probably damaging 0.98
R4707:Olfr1221 UTSW 2 89112232 missense probably damaging 0.98
R5133:Olfr1221 UTSW 2 89111796 unclassified probably null
R6629:Olfr1221 UTSW 2 89112162 missense probably benign 0.09
R6644:Olfr1221 UTSW 2 89111981 missense probably benign 0.00
R6723:Olfr1221 UTSW 2 89112296 missense possibly damaging 0.81
R6725:Olfr1221 UTSW 2 89112296 missense possibly damaging 0.81
R6754:Olfr1221 UTSW 2 89112296 missense possibly damaging 0.81
R6765:Olfr1221 UTSW 2 89112296 missense possibly damaging 0.81
R6766:Olfr1221 UTSW 2 89112296 missense possibly damaging 0.81
R7215:Olfr1221 UTSW 2 89112501 nonsense probably null
R7562:Olfr1221 UTSW 2 89112285 missense probably benign 0.00
R7681:Olfr1221 UTSW 2 89111591 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATTGAATTTGCAGTTTGTCAAGCC -3'
(R):5'- TGGGTCCCATATTACAGTCGTTG -3'

Sequencing Primer
(F):5'- GCAGTTTGTCAAGCCTATTAGATTG -3'
(R):5'- ACAGTCGTTGTTTTATTCTTTGTTC -3'
Posted On2015-07-21