Incidental Mutation 'R0052:Pld4'
ID33062
Institutional Source Beutler Lab
Gene Symbol Pld4
Ensembl Gene ENSMUSG00000052160
Gene Namephospholipase D family, member 4
Synonymsthss
MMRRC Submission 038346-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0052 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location112760655-112768990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112767857 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 386 (F386I)
Ref Sequence ENSEMBL: ENSMUSP00000067002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063888] [ENSMUST00000101010] [ENSMUST00000128258]
Predicted Effect probably benign
Transcript: ENSMUST00000063888
AA Change: F386I

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000067002
Gene: ENSMUSG00000052160
AA Change: F386I

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
low complexity region 113 124 N/A INTRINSIC
PLDc 207 234 1.64e-10 SMART
Pfam:PLDc_3 237 414 5.5e-41 PFAM
PLDc 421 447 4.66e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101010
SMART Domains Protein: ENSMUSP00000098572
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
low complexity region 5 14 N/A INTRINSIC
low complexity region 364 375 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 717 733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128258
SMART Domains Protein: ENSMUSP00000122404
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
low complexity region 5 66 N/A INTRINSIC
internal_repeat_1 67 251 2.35e-83 PROSPERO
low complexity region 285 308 N/A INTRINSIC
low complexity region 371 389 N/A INTRINSIC
internal_repeat_1 413 597 2.35e-83 PROSPERO
low complexity region 734 756 N/A INTRINSIC
low complexity region 811 820 N/A INTRINSIC
low complexity region 1170 1181 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1523 1539 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222886
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 97% (65/67)
MGI Phenotype PHENOTYPE: A spontaneous mutation that introduces a stop codon at residue 46 of 503 results in smaller body size and thin fur. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 T C 19: 23,915,951 S438P possibly damaging Het
Atp2a1 A G 7: 126,457,897 probably benign Het
Axin2 T C 11: 108,949,270 Y735H probably damaging Het
Bicd2 T A 13: 49,375,314 L184Q probably damaging Het
Bub1 G A 2: 127,809,039 T618I probably benign Het
Catsperg2 A G 7: 29,725,020 probably benign Het
Ccdc73 T A 2: 104,929,570 probably benign Het
Crybg3 A T 16: 59,565,656 probably benign Het
Dsp A G 13: 38,197,364 D2096G possibly damaging Het
Eef2 C CN 10: 81,178,768 probably null Het
Elp3 A G 14: 65,531,526 *548Q probably null Het
Eno4 A G 19: 58,968,553 D357G probably damaging Het
Fam214a A G 9: 75,018,983 probably benign Het
Fcrls A T 3: 87,256,778 I348N possibly damaging Het
Fgl2 A T 5: 21,375,349 S230C probably damaging Het
Ginm1 T A 10: 7,779,306 E57D possibly damaging Het
Gtf3c1 A T 7: 125,667,971 probably null Het
Herc1 G T 9: 66,400,156 G1044V probably damaging Het
Hmcn1 G A 1: 150,677,406 T2511M probably damaging Het
Iba57 C T 11: 59,158,901 A207T probably benign Het
Itga9 T A 9: 118,636,549 I157N probably damaging Het
Kalrn A G 16: 34,357,171 L208P probably damaging Het
Kcnj10 A G 1: 172,368,924 T2A probably benign Het
Kdm1b T A 13: 47,064,117 C351S probably damaging Het
Kif21a T C 15: 90,970,857 E700G probably damaging Het
Mmd C T 11: 90,259,998 probably benign Het
Mocs3 C T 2: 168,231,682 P350S probably benign Het
Morn3 T C 5: 123,046,663 Y38C probably damaging Het
Nacc1 A T 8: 84,676,225 V313D probably benign Het
Nbeal1 T A 1: 60,228,612 probably benign Het
Neb T C 2: 52,273,980 K1989E possibly damaging Het
Nlrp3 C T 11: 59,565,128 R917* probably null Het
Nlrp4b T A 7: 10,725,962 Y463* probably null Het
Perm1 A T 4: 156,218,115 D372V probably damaging Het
Phf3 T C 1: 30,808,767 T1232A probably damaging Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Prex2 T A 1: 11,160,156 L802Q probably damaging Het
Psd3 A G 8: 67,882,979 probably null Het
Ralgds T A 2: 28,544,388 probably null Het
Rmdn2 A G 17: 79,650,331 E16G probably damaging Het
Rnf111 A T 9: 70,476,389 S87R probably benign Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc9c1 A G 16: 45,606,856 probably benign Het
Slco3a1 A T 7: 74,504,326 I166N probably benign Het
Snx5 A T 2: 144,259,192 probably null Het
Srgap1 T C 10: 121,800,827 D741G possibly damaging Het
St8sia2 G T 7: 73,943,290 Y339* probably null Het
St8sia2 A T 7: 73,971,952 W86R probably damaging Het
Stk33 A G 7: 109,279,669 L491P possibly damaging Het
Sult2a7 T C 7: 14,465,208 Y298C probably damaging Het
Tdo2 T A 3: 81,967,025 N210I probably benign Het
Thada A T 17: 84,455,158 N104K probably damaging Het
Timm8b A T 9: 50,605,030 D61V possibly damaging Het
Tshz1 G A 18: 84,014,945 T446I possibly damaging Het
Ubap2l T C 3: 90,038,928 N123S possibly damaging Het
Vmn1r48 T C 6: 90,036,264 E193G possibly damaging Het
Vmn1r69 C T 7: 10,580,400 V135I probably benign Het
Vmn2r103 G T 17: 19,811,641 G559V probably benign Het
Vmn2r26 T A 6: 124,062,033 *856R probably null Het
Vmn2r88 A G 14: 51,418,700 I798V possibly damaging Het
Vsir C T 10: 60,358,082 A108V probably benign Het
Zfp14 G T 7: 30,038,328 Q411K probably damaging Het
Zfp236 A T 18: 82,639,332 M762K probably damaging Het
Zfp462 G A 4: 55,011,762 G1243S probably benign Het
Other mutations in Pld4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Pld4 APN 12 112763491 missense probably benign 0.01
IGL01839:Pld4 APN 12 112765079 missense probably damaging 1.00
IGL01954:Pld4 APN 12 112767921 critical splice donor site probably null
IGL02253:Pld4 APN 12 112766707 missense probably damaging 1.00
IGL03149:Pld4 APN 12 112766829 missense probably benign 0.00
IGL03278:Pld4 APN 12 112766731 missense probably damaging 0.98
IGL03349:Pld4 APN 12 112767879 missense probably benign 0.01
Lipodicum UTSW 12 112765064 missense probably damaging 1.00
PIT4403001:Pld4 UTSW 12 112767822 missense probably damaging 1.00
PIT4468001:Pld4 UTSW 12 112767822 missense probably damaging 1.00
R1078:Pld4 UTSW 12 112763442 missense probably benign
R1756:Pld4 UTSW 12 112763392 splice site probably null
R2006:Pld4 UTSW 12 112768489 missense possibly damaging 0.89
R2037:Pld4 UTSW 12 112768558 missense probably damaging 1.00
R3738:Pld4 UTSW 12 112768035 missense probably benign 0.07
R4630:Pld4 UTSW 12 112765064 missense probably damaging 1.00
R4911:Pld4 UTSW 12 112764517 missense probably benign 0.01
R5008:Pld4 UTSW 12 112768050 missense possibly damaging 0.89
R5263:Pld4 UTSW 12 112765031 missense probably damaging 1.00
R5310:Pld4 UTSW 12 112768612 missense probably damaging 1.00
R5386:Pld4 UTSW 12 112763988 nonsense probably null
R5513:Pld4 UTSW 12 112762554 missense probably benign
R5788:Pld4 UTSW 12 112764117 missense probably benign
R6085:Pld4 UTSW 12 112766886 missense probably benign 0.01
R6157:Pld4 UTSW 12 112768101 missense probably damaging 1.00
R6702:Pld4 UTSW 12 112765051 missense probably damaging 1.00
R6767:Pld4 UTSW 12 112764115 missense possibly damaging 0.51
R6962:Pld4 UTSW 12 112766854 missense probably benign 0.00
R7864:Pld4 UTSW 12 112765123 missense probably damaging 1.00
R8792:Pld4 UTSW 12 112763490 missense probably benign 0.00
R8826:Pld4 UTSW 12 112766776 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCCTGGTTGGCAAGTCCTAGACAC -3'
(R):5'- TGTTGGAATGATTTCCCACAGGCAC -3'

Sequencing Primer
(F):5'- GTCCTAGACACAGTGTACCTG -3'
(R):5'- CAGGCACGATGAAGACTTTC -3'
Posted On2013-05-09