Incidental Mutation 'R4489:Csmd2'
ID330625
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene NameCUB and Sushi multiple domains 2
Synonyms
MMRRC Submission 041745-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R4489 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location127987857-128567656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128381945 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 826 (V826M)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144298
Predicted Effect possibly damaging
Transcript: ENSMUST00000184063
AA Change: V826M

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.0892 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 94% (50/53)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,220,702 Y250H probably benign Het
4932438A13Rik A T 3: 37,003,933 Q3224L probably null Het
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Ank3 C T 10: 69,898,256 A754V probably damaging Het
Ano1 T C 7: 144,611,742 N582S probably benign Het
Arnt2 T A 7: 84,275,345 T425S probably benign Het
Cand2 A G 6: 115,789,466 D344G probably damaging Het
Clta T G 4: 44,032,417 F198V probably damaging Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Dnah11 C T 12: 117,916,896 V3830I probably benign Het
Fhl4 T C 10: 85,098,455 D154G possibly damaging Het
Gbp4 T A 5: 105,121,907 T352S probably damaging Het
Gigyf2 A G 1: 87,440,826 D1076G probably damaging Het
Gm21370 T A 13: 120,026,842 Y57F probably benign Het
Gm6489 A G 1: 31,287,239 noncoding transcript Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hectd4 T G 5: 121,286,257 I660R possibly damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Htr1b A T 9: 81,631,539 D338E probably benign Het
Kif1bp A G 10: 62,563,027 probably benign Het
Lrp1b T C 2: 40,661,489 probably benign Het
Lzts1 T A 8: 69,135,695 K536N possibly damaging Het
Mrpl22 T A 11: 58,173,102 N49K probably benign Het
Mzt1 T C 14: 99,036,490 *42W probably null Het
Nkx3-2 T G 5: 41,761,961 Q228P probably damaging Het
Nufip2 T G 11: 77,686,229 M1R probably null Het
Obscn G A 11: 59,031,591 T5921M possibly damaging Het
Olfr1221 T C 2: 89,111,572 probably null Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Pcdha11 C A 18: 37,006,916 Q533K possibly damaging Het
Pgm5 T C 19: 24,816,445 E285G probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rgs21 T C 1: 144,519,875 T92A possibly damaging Het
Rgsl1 T A 1: 153,827,536 Y123F probably benign Het
Rnf13 A C 3: 57,820,589 K230T probably damaging Het
Sgf29 T C 7: 126,663,938 S29P possibly damaging Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Specc1 T G 11: 62,151,827 probably null Het
Tg A T 15: 66,707,942 Q1532L probably damaging Het
Timm44 A C 8: 4,266,654 S297A possibly damaging Het
Txndc9 G T 1: 37,995,790 S11* probably null Het
Uggt1 C T 1: 36,146,668 W1478* probably null Het
Washc3 T C 10: 88,216,031 V87A probably benign Het
Xlr5b T C X: 73,157,898 probably null Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128483473 missense probably benign 0.03
IGL01098:Csmd2 APN 4 128059052 missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128369130 missense probably benign 0.04
IGL01364:Csmd2 APN 4 128414288 missense probably benign 0.01
IGL01530:Csmd2 APN 4 128414301 missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128563305 nonsense probably null
IGL01670:Csmd2 APN 4 128513371 splice site probably benign
IGL01707:Csmd2 APN 4 128383005 missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128480845 splice site probably benign
IGL01837:Csmd2 APN 4 128419570 missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128559947 missense unknown
IGL02013:Csmd2 APN 4 128321323 missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128559879 missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128477470 splice site probably benign
IGL02303:Csmd2 APN 4 128369008 missense probably benign 0.01
IGL02317:Csmd2 APN 4 128463727 splice site probably benign
IGL02322:Csmd2 APN 4 128463727 splice site probably benign
IGL02338:Csmd2 APN 4 128395066 missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128513372 splice site probably benign
IGL02428:Csmd2 APN 4 128474816 missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128534257 missense probably benign
IGL02701:Csmd2 APN 4 128496141 missense probably benign 0.17
IGL02801:Csmd2 APN 4 128552075 splice site probably null
IGL02818:Csmd2 APN 4 128209728 missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128521884 missense probably benign 0.00
IGL02876:Csmd2 APN 4 128321335 nonsense probably null
IGL02977:Csmd2 APN 4 128493276 nonsense probably null
IGL03006:Csmd2 APN 4 128480765 splice site probably benign
IGL03032:Csmd2 APN 4 128519041 missense probably benign 0.03
IGL03148:Csmd2 APN 4 128384269 missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128414299 nonsense probably null
IGL03245:Csmd2 APN 4 128509122 missense probably benign 0.12
IGL03376:Csmd2 APN 4 128517671 missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128296429 missense probably benign 0.01
R0109:Csmd2 UTSW 4 128544743 missense probably benign 0.03
R0112:Csmd2 UTSW 4 128496029 missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128521911 missense probably benign 0.02
R0390:Csmd2 UTSW 4 128133673 intron probably benign
R0441:Csmd2 UTSW 4 128520230 missense probably benign 0.00
R0519:Csmd2 UTSW 4 128487005 missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128113676 missense probably benign 0.00
R0746:Csmd2 UTSW 4 128414297 missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128496188 missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128522014 missense probably benign 0.00
R1476:Csmd2 UTSW 4 128487001 missense probably benign 0.08
R1641:Csmd2 UTSW 4 128483395 missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128496195 missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128414392 critical splice donor site probably null
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2873:Csmd2 UTSW 4 128557718 missense unknown
R2893:Csmd2 UTSW 4 128538993 intron probably null
R3796:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3797:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3798:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3914:Csmd2 UTSW 4 128321324 missense probably benign 0.07
R4198:Csmd2 UTSW 4 128510924 missense probably benign 0.07
R4571:Csmd2 UTSW 4 128480095 splice site probably null
R4581:Csmd2 UTSW 4 128369088 missense probably benign 0.02
R4599:Csmd2 UTSW 4 127988128 missense probably benign 0.35
R4649:Csmd2 UTSW 4 128546073 missense probably benign
R4706:Csmd2 UTSW 4 128544751 missense probably benign
R4776:Csmd2 UTSW 4 128442892 missense probably benign 0.09
R4838:Csmd2 UTSW 4 128517749 missense probably benign
R4900:Csmd2 UTSW 4 128452525 missense probably benign 0.03
R4999:Csmd2 UTSW 4 128521930 missense probably benign 0.00
R5024:Csmd2 UTSW 4 128321348 missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128059108 missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128552035 missense probably benign 0.27
R5172:Csmd2 UTSW 4 128477397 missense probably benign 0.10
R5231:Csmd2 UTSW 4 128546049 missense probably benign 0.00
R5279:Csmd2 UTSW 4 128456914 missense probably benign 0.30
R5287:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5403:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5410:Csmd2 UTSW 4 128548819 missense probably benign
R5551:Csmd2 UTSW 4 128510948 missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128462889 critical splice donor site probably null
R5826:Csmd2 UTSW 4 128519199 splice site probably null
R5907:Csmd2 UTSW 4 128197385 missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128551988 missense probably benign 0.01
R5970:Csmd2 UTSW 4 128546151 missense probably benign 0.00
R5977:Csmd2 UTSW 4 128059034 missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128559946 missense unknown
R6075:Csmd2 UTSW 4 128486865 missense probably benign 0.15
R6129:Csmd2 UTSW 4 128493334 missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128400379 missense probably benign 0.00
R6366:Csmd2 UTSW 4 128483452 missense probably benign 0.00
R6404:Csmd2 UTSW 4 128521950 missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127988100 missense probably benign 0.24
R6441:Csmd2 UTSW 4 128394964 missense probably benign 0.03
R6643:Csmd2 UTSW 4 128372597 missense probably benign 0.14
R6724:Csmd2 UTSW 4 128563371 missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128463813 missense probably benign 0.00
R6750:Csmd2 UTSW 4 128197225 missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128383950 missense probably benign 0.11
R6842:Csmd2 UTSW 4 128509159 missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128463794 missense probably benign 0.27
R6868:Csmd2 UTSW 4 128442840 missense probably benign
R6882:Csmd2 UTSW 4 128449269 missense probably benign 0.01
R7019:Csmd2 UTSW 4 128369063 missense
R7028:Csmd2 UTSW 4 128277228 missense
R7096:Csmd2 UTSW 4 128462726 missense
R7122:Csmd2 UTSW 4 128449227 missense
R7125:Csmd2 UTSW 4 128496162 missense
R7197:Csmd2 UTSW 4 128511033 missense
R7234:Csmd2 UTSW 4 128456779 missense
R7299:Csmd2 UTSW 4 128528262 missense
R7301:Csmd2 UTSW 4 128528262 missense
R7319:Csmd2 UTSW 4 128393679 missense
R7331:Csmd2 UTSW 4 128564228 splice site probably null
R7332:Csmd2 UTSW 4 128419567 missense
R7352:Csmd2 UTSW 4 128557636 missense
R7402:Csmd2 UTSW 4 128322095 missense
R7402:Csmd2 UTSW 4 128322096 missense
R7474:Csmd2 UTSW 4 128546127 missense
R7555:Csmd2 UTSW 4 128452458 missense
R7592:Csmd2 UTSW 4 128463798 missense
R7700:Csmd2 UTSW 4 128545756 intron probably null
R7714:Csmd2 UTSW 4 128382950 nonsense probably null
R7734:Csmd2 UTSW 4 128552057 missense
R7735:Csmd2 UTSW 4 128456930 critical splice donor site probably null
R7757:Csmd2 UTSW 4 128483456 missense
R7805:Csmd2 UTSW 4 128419573 missense
R7823:Csmd2 UTSW 4 128209905 missense
R7904:Csmd2 UTSW 4 128419553 missense
R7946:Csmd2 UTSW 4 128520265 missense
R7964:Csmd2 UTSW 4 128523510 missense
R7968:Csmd2 UTSW 4 128197325 missense
R8003:Csmd2 UTSW 4 128539187 nonsense probably null
R8071:Csmd2 UTSW 4 128393538 missense
Z1177:Csmd2 UTSW 4 128530797 missense
Predicted Primers PCR Primer
(F):5'- TCGGCAAAGCTCACAGTTTAGAC -3'
(R):5'- AGGCAGTCATCCCCATATCCTC -3'

Sequencing Primer
(F):5'- TGGCTGACACATTTTATAGAGAGG -3'
(R):5'- AGTCATCCCCATATCCTCCACCC -3'
Posted On2015-07-21