Incidental Mutation 'R4489:Arnt2'
ID330631
Institutional Source Beutler Lab
Gene Symbol Arnt2
Ensembl Gene ENSMUSG00000015709
Gene Namearyl hydrocarbon receptor nuclear translocator 2
SynonymsbHLHe1
MMRRC Submission 041745-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4489 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location84246278-84410176 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84275345 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 425 (T425S)
Ref Sequence ENSEMBL: ENSMUSP00000147129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085077] [ENSMUST00000208232] [ENSMUST00000209133]
Predicted Effect probably benign
Transcript: ENSMUST00000085077
AA Change: T436S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082154
Gene: ENSMUSG00000015709
AA Change: T436S

DomainStartEndE-ValueType
HLH 69 122 1.42e-14 SMART
PAS 137 204 1.28e-8 SMART
low complexity region 225 236 N/A INTRINSIC
PAS 325 391 4.15e-8 SMART
PAC 398 441 7.93e-5 SMART
low complexity region 502 526 N/A INTRINSIC
low complexity region 597 626 N/A INTRINSIC
low complexity region 653 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207459
Predicted Effect probably benign
Transcript: ENSMUST00000208129
Predicted Effect probably benign
Transcript: ENSMUST00000208232
AA Change: T425S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208936
Predicted Effect probably benign
Transcript: ENSMUST00000209133
AA Change: T425S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0768 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 94% (50/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic-helix-loop-helix-Per-Arnt-Sim (bHLH-PAS) superfamily of transcription factors. The encoded protein acts as a partner for several sensor proteins of the bHLH-PAS family, forming heterodimers with the sensor proteins that bind regulatory DNA sequences in genes responsive to developmental and environmental stimuli. Under hypoxic conditions, the encoded protein complexes with hypoxia-inducible factor 1alpha in the nucleus and this complex binds to hypoxia-responsive elements in enhancers and promoters of oxygen-responsive genes. A highly similar protein in mouse forms functional complexes with both aryl hydrocarbon receptors and Single-minded proteins, suggesting additional roles for the encoded protein in the metabolism of xenobiotic compounds and the regulation of neurogenesis, respectively. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate this gene die shortly after birth, displaying impaired development of secretory neurons in the hypothalamus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,220,702 Y250H probably benign Het
4932438A13Rik A T 3: 37,003,933 Q3224L probably null Het
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Ank3 C T 10: 69,898,256 A754V probably damaging Het
Ano1 T C 7: 144,611,742 N582S probably benign Het
Cand2 A G 6: 115,789,466 D344G probably damaging Het
Clta T G 4: 44,032,417 F198V probably damaging Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Csmd2 G A 4: 128,381,945 V826M possibly damaging Het
Dnah11 C T 12: 117,916,896 V3830I probably benign Het
Fhl4 T C 10: 85,098,455 D154G possibly damaging Het
Gbp4 T A 5: 105,121,907 T352S probably damaging Het
Gigyf2 A G 1: 87,440,826 D1076G probably damaging Het
Gm21370 T A 13: 120,026,842 Y57F probably benign Het
Gm6489 A G 1: 31,287,239 noncoding transcript Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hectd4 T G 5: 121,286,257 I660R possibly damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Htr1b A T 9: 81,631,539 D338E probably benign Het
Kif1bp A G 10: 62,563,027 probably benign Het
Lrp1b T C 2: 40,661,489 probably benign Het
Lzts1 T A 8: 69,135,695 K536N possibly damaging Het
Mrpl22 T A 11: 58,173,102 N49K probably benign Het
Mzt1 T C 14: 99,036,490 *42W probably null Het
Nkx3-2 T G 5: 41,761,961 Q228P probably damaging Het
Nufip2 T G 11: 77,686,229 M1R probably null Het
Obscn G A 11: 59,031,591 T5921M possibly damaging Het
Olfr1221 T C 2: 89,111,572 probably null Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Pcdha11 C A 18: 37,006,916 Q533K possibly damaging Het
Pgm5 T C 19: 24,816,445 E285G probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rgs21 T C 1: 144,519,875 T92A possibly damaging Het
Rgsl1 T A 1: 153,827,536 Y123F probably benign Het
Rnf13 A C 3: 57,820,589 K230T probably damaging Het
Sgf29 T C 7: 126,663,938 S29P possibly damaging Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Specc1 T G 11: 62,151,827 probably null Het
Tg A T 15: 66,707,942 Q1532L probably damaging Het
Timm44 A C 8: 4,266,654 S297A possibly damaging Het
Txndc9 G T 1: 37,995,790 S11* probably null Het
Uggt1 C T 1: 36,146,668 W1478* probably null Het
Washc3 T C 10: 88,216,031 V87A probably benign Het
Xlr5b T C X: 73,157,898 probably null Het
Other mutations in Arnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Arnt2 APN 7 84285829 missense probably benign 0.01
IGL01525:Arnt2 APN 7 84275408 missense possibly damaging 0.70
IGL02331:Arnt2 APN 7 84265624 missense probably damaging 1.00
IGL02483:Arnt2 APN 7 84251397 missense probably damaging 1.00
IGL02863:Arnt2 APN 7 84267937 missense probably damaging 1.00
IGL03207:Arnt2 APN 7 84343834 missense possibly damaging 0.93
Arnold2 UTSW 7 84347530 missense probably damaging 1.00
porker UTSW 7 84343942 missense probably damaging 1.00
R0024:Arnt2 UTSW 7 84284126 missense probably benign 0.03
R0058:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0058:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0060:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0113:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0114:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0201:Arnt2 UTSW 7 84361659 nonsense probably null
R0514:Arnt2 UTSW 7 84304859 missense probably benign 0.00
R0863:Arnt2 UTSW 7 84265584 missense probably damaging 1.00
R1800:Arnt2 UTSW 7 84275375 missense probably damaging 1.00
R1944:Arnt2 UTSW 7 84343751 missense probably benign 0.01
R1964:Arnt2 UTSW 7 84343789 missense possibly damaging 0.55
R2061:Arnt2 UTSW 7 84343870 missense probably damaging 1.00
R2216:Arnt2 UTSW 7 84275351 missense probably damaging 0.99
R3107:Arnt2 UTSW 7 84262444 missense possibly damaging 0.95
R3410:Arnt2 UTSW 7 84275447 missense probably damaging 1.00
R3739:Arnt2 UTSW 7 84343801 missense probably null 1.00
R4258:Arnt2 UTSW 7 84310955 missense probably damaging 0.98
R4486:Arnt2 UTSW 7 84275345 missense probably benign 0.03
R4668:Arnt2 UTSW 7 84275386 missense probably damaging 1.00
R5685:Arnt2 UTSW 7 84263265 missense probably benign 0.00
R5876:Arnt2 UTSW 7 84347512 missense probably damaging 1.00
R5923:Arnt2 UTSW 7 84262533 missense probably benign 0.32
R5926:Arnt2 UTSW 7 84343946 missense probably damaging 0.99
R6122:Arnt2 UTSW 7 84361565 missense probably damaging 1.00
R7021:Arnt2 UTSW 7 84343942 missense probably damaging 1.00
R7895:Arnt2 UTSW 7 84305198 missense probably benign
R7898:Arnt2 UTSW 7 84268947 splice site probably null
R8386:Arnt2 UTSW 7 84347539 missense probably damaging 1.00
X0066:Arnt2 UTSW 7 84285784 missense possibly damaging 0.93
Z1176:Arnt2 UTSW 7 84263196 missense probably benign 0.41
Z1177:Arnt2 UTSW 7 84263207 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ATGGAAGGGATGCACACCAC -3'
(R):5'- ATGAGCCTAGCTGCTACCTG -3'

Sequencing Primer
(F):5'- CAGTAAAGGAAACCCAGAGTCTC -3'
(R):5'- AGCAGCACCCCATTCTGTG -3'
Posted On2015-07-21