Mutagenetix > Incidental Mutations

Incidental Mutation 'R4489:Arnt2'

330631

Institutional Source

Beutler Lab

Gene Symbol

Arnt2

Ensembl Gene

ENSMUSG00000015709

Gene Name

aryl hydrocarbon receptor nuclear translocator 2

Synonyms

bHLHe1

MMRRC Submission

041745-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4489 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84246278-84410176 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 84275345 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 425 (T425S)

Ref Sequence

ENSEMBL: ENSMUSP00000147129 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085077] [ENSMUST00000208232] [ENSMUST00000209133]

Predicted Effect

probably benign
Transcript: ENSMUST00000085077
AA Change: T436S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000082154
Gene: ENSMUSG00000015709
AA Change: T436S

Domain	Start	End	E-Value	Type
HLH	69	122	1.42e-14	SMART
PAS	137	204	1.28e-8	SMART
low complexity region	225	236	N/A	INTRINSIC
PAS	325	391	4.15e-8	SMART
PAC	398	441	7.93e-5	SMART
low complexity region	502	526	N/A	INTRINSIC
low complexity region	597	626	N/A	INTRINSIC
low complexity region	653	675	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207459

Predicted Effect

probably benign
Transcript: ENSMUST00000208129

Predicted Effect

probably benign
Transcript: ENSMUST00000208232
AA Change: T425S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208936

Predicted Effect

probably benign
Transcript: ENSMUST00000209133
AA Change: T425S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

Meta Mutation Damage Score

0.0768

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

94% (50/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic-helix-loop-helix-Per-Arnt-Sim (bHLH-PAS) superfamily of transcription factors. The encoded protein acts as a partner for several sensor proteins of the bHLH-PAS family, forming heterodimers with the sensor proteins that bind regulatory DNA sequences in genes responsive to developmental and environmental stimuli. Under hypoxic conditions, the encoded protein complexes with hypoxia-inducible factor 1alpha in the nucleus and this complex binds to hypoxia-responsive elements in enhancers and promoters of oxygen-responsive genes. A highly similar protein in mouse forms functional complexes with both aryl hydrocarbon receptors and Single-minded proteins, suggesting additional roles for the encoded protein in the metabolism of xenobiotic compounds and the regulation of neurogenesis, respectively. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate this gene die shortly after birth, displaying impaired development of secretory neurons in the hypothalamus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	A	G	2: 111,220,702	Y250H	probably benign	Het
4932438A13Rik	A	T	3: 37,003,933	Q3224L	probably null	Het
Abcd2	A	G	15: 91,178,283	V484A	probably damaging	Het
Ank3	C	T	10: 69,898,256	A754V	probably damaging	Het
Ano1	T	C	7: 144,611,742	N582S	probably benign	Het
Cand2	A	G	6: 115,789,466	D344G	probably damaging	Het
Clta	T	G	4: 44,032,417	F198V	probably damaging	Het
Cnga2	T	A	X: 72,006,127	F133I	possibly damaging	Het
Csmd2	G	A	4: 128,381,945	V826M	possibly damaging	Het
Dnah11	C	T	12: 117,916,896	V3830I	probably benign	Het
Fhl4	T	C	10: 85,098,455	D154G	possibly damaging	Het
Gbp4	T	A	5: 105,121,907	T352S	probably damaging	Het
Gigyf2	A	G	1: 87,440,826	D1076G	probably damaging	Het
Gm21370	T	A	13: 120,026,842	Y57F	probably benign	Het
Gm6489	A	G	1: 31,287,239		noncoding transcript	Het
Grm6	T	C	11: 50,859,989	S660P	probably damaging	Het
Hectd4	T	G	5: 121,286,257	I660R	possibly damaging	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Htr1b	A	T	9: 81,631,539	D338E	probably benign	Het
Kif1bp	A	G	10: 62,563,027		probably benign	Het
Lrp1b	T	C	2: 40,661,489		probably benign	Het
Lzts1	T	A	8: 69,135,695	K536N	possibly damaging	Het
Mrpl22	T	A	11: 58,173,102	N49K	probably benign	Het
Mzt1	T	C	14: 99,036,490	*42W	probably null	Het
Nkx3-2	T	G	5: 41,761,961	Q228P	probably damaging	Het
Nufip2	T	G	11: 77,686,229	M1R	probably null	Het
Obscn	G	A	11: 59,031,591	T5921M	possibly damaging	Het
Olfr1221	T	C	2: 89,111,572		probably null	Het
Olfr676	T	C	7: 105,035,303	F35S	probably benign	Het
Pcdha11	C	A	18: 37,006,916	Q533K	possibly damaging	Het
Pgm5	T	C	19: 24,816,445	E285G	probably benign	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Rgs21	T	C	1: 144,519,875	T92A	possibly damaging	Het
Rgsl1	T	A	1: 153,827,536	Y123F	probably benign	Het
Rnf13	A	C	3: 57,820,589	K230T	probably damaging	Het
Sgf29	T	C	7: 126,663,938	S29P	possibly damaging	Het
Smchd1	T	C	17: 71,407,235	T878A	probably benign	Het
Specc1	T	G	11: 62,151,827		probably null	Het
Tg	A	T	15: 66,707,942	Q1532L	probably damaging	Het
Timm44	A	C	8: 4,266,654	S297A	possibly damaging	Het
Txndc9	G	T	1: 37,995,790	S11*	probably null	Het
Uggt1	C	T	1: 36,146,668	W1478*	probably null	Het
Washc3	T	C	10: 88,216,031	V87A	probably benign	Het
Xlr5b	T	C	X: 73,157,898		probably null	Het

Other mutations in Arnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Arnt2	APN	7	84285829	missense	probably benign	0.01
IGL01525:Arnt2	APN	7	84275408	missense	possibly damaging	0.70
IGL02331:Arnt2	APN	7	84265624	missense	probably damaging	1.00
IGL02483:Arnt2	APN	7	84251397	missense	probably damaging	1.00
IGL02863:Arnt2	APN	7	84267937	missense	probably damaging	1.00
IGL03207:Arnt2	APN	7	84343834	missense	possibly damaging	0.93
Arnold2	UTSW	7	84347530	missense	probably damaging	1.00
porker	UTSW	7	84343942	missense	probably damaging	1.00
R0024:Arnt2	UTSW	7	84284126	missense	probably benign	0.03
R0058:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0058:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0060:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0113:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0114:Arnt2	UTSW	7	84347530	missense	probably damaging	1.00
R0201:Arnt2	UTSW	7	84361659	nonsense	probably null
R0514:Arnt2	UTSW	7	84304859	missense	probably benign	0.00
R0863:Arnt2	UTSW	7	84265584	missense	probably damaging	1.00
R1800:Arnt2	UTSW	7	84275375	missense	probably damaging	1.00
R1944:Arnt2	UTSW	7	84343751	missense	probably benign	0.01
R1964:Arnt2	UTSW	7	84343789	missense	possibly damaging	0.55
R2061:Arnt2	UTSW	7	84343870	missense	probably damaging	1.00
R2216:Arnt2	UTSW	7	84275351	missense	probably damaging	0.99
R3107:Arnt2	UTSW	7	84262444	missense	possibly damaging	0.95
R3410:Arnt2	UTSW	7	84275447	missense	probably damaging	1.00
R3739:Arnt2	UTSW	7	84343801	missense	probably null	1.00
R4258:Arnt2	UTSW	7	84310955	missense	probably damaging	0.98
R4486:Arnt2	UTSW	7	84275345	missense	probably benign	0.03
R4668:Arnt2	UTSW	7	84275386	missense	probably damaging	1.00
R5685:Arnt2	UTSW	7	84263265	missense	probably benign	0.00
R5876:Arnt2	UTSW	7	84347512	missense	probably damaging	1.00
R5923:Arnt2	UTSW	7	84262533	missense	probably benign	0.32
R5926:Arnt2	UTSW	7	84343946	missense	probably damaging	0.99
R6122:Arnt2	UTSW	7	84361565	missense	probably damaging	1.00
R7021:Arnt2	UTSW	7	84343942	missense	probably damaging	1.00
X0066:Arnt2	UTSW	7	84285784	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- ATGGAAGGGATGCACACCAC -3'
(R):5'- ATGAGCCTAGCTGCTACCTG -3'

Sequencing Primer
(F):5'- CAGTAAAGGAAACCCAGAGTCTC -3'
(R):5'- AGCAGCACCCCATTCTGTG -3'

Posted On

2015-07-21