Mutagenetix > Incidental Mutations

Incidental Mutation 'R4489:Sgf29'

330633

Institutional Source

Beutler Lab

Gene Symbol

Sgf29

Ensembl Gene

ENSMUSG00000030714

Gene Name

SAGA complex associated factor 29

Synonyms

1700023O11Rik, Ccdc101

MMRRC Submission

041745-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4489 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126649309-126672925 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 126663938 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 29 (S29P)

Ref Sequence

ENSEMBL: ENSMUSP00000146122 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032956] [ENSMUST00000126570] [ENSMUST00000205507] [ENSMUST00000206359]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032956
AA Change: S29P

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000032956
Gene: ENSMUSG00000030714
AA Change: S29P

Domain	Start	End	E-Value	Type
coiled coil region	66	86	N/A	INTRINSIC
Pfam:DUF1325	158	288	5.2e-43	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123274

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123571

Predicted Effect

probably benign
Transcript: ENSMUST00000126570

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138794

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152231

Predicted Effect

possibly damaging
Transcript: ENSMUST00000205507
AA Change: S29P

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206359
AA Change: S29P

PolyPhen 2 Score 0.616 (Sensitivity: 0.87; Specificity: 0.91)

Meta Mutation Damage Score

0.0682

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

94% (50/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CCDC101 is a subunit of 2 histone acetyltransferase complexes: the ADA2A (TADA2A; MIM 602276)-containing (ATAC) complex and the SPT3 (SUPT3H; MIM 602947)-TAF9 (MIM 600822)-GCN5 (KAT2A; MIM 602301)/PCAF (KAT2B; MIM 602303) acetylase (STAGA) complex. Both of these complexes contain either GCN5 or PCAF, which are paralogous acetyltransferases (Wang et al., 2008 [PubMed 18838386]).[supplied by OMIM, Apr 2010]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	A	G	2: 111,220,702	Y250H	probably benign	Het
4932438A13Rik	A	T	3: 37,003,933	Q3224L	probably null	Het
Abcd2	A	G	15: 91,178,283	V484A	probably damaging	Het
Ank3	C	T	10: 69,898,256	A754V	probably damaging	Het
Ano1	T	C	7: 144,611,742	N582S	probably benign	Het
Arnt2	T	A	7: 84,275,345	T425S	probably benign	Het
Cand2	A	G	6: 115,789,466	D344G	probably damaging	Het
Clta	T	G	4: 44,032,417	F198V	probably damaging	Het
Cnga2	T	A	X: 72,006,127	F133I	possibly damaging	Het
Csmd2	G	A	4: 128,381,945	V826M	possibly damaging	Het
Dnah11	C	T	12: 117,916,896	V3830I	probably benign	Het
Fhl4	T	C	10: 85,098,455	D154G	possibly damaging	Het
Gbp4	T	A	5: 105,121,907	T352S	probably damaging	Het
Gigyf2	A	G	1: 87,440,826	D1076G	probably damaging	Het
Gm21370	T	A	13: 120,026,842	Y57F	probably benign	Het
Gm6489	A	G	1: 31,287,239		noncoding transcript	Het
Grm6	T	C	11: 50,859,989	S660P	probably damaging	Het
Hectd4	T	G	5: 121,286,257	I660R	possibly damaging	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Htr1b	A	T	9: 81,631,539	D338E	probably benign	Het
Kif1bp	A	G	10: 62,563,027		probably benign	Het
Lrp1b	T	C	2: 40,661,489		probably benign	Het
Lzts1	T	A	8: 69,135,695	K536N	possibly damaging	Het
Mrpl22	T	A	11: 58,173,102	N49K	probably benign	Het
Mzt1	T	C	14: 99,036,490	*42W	probably null	Het
Nkx3-2	T	G	5: 41,761,961	Q228P	probably damaging	Het
Nufip2	T	G	11: 77,686,229	M1R	probably null	Het
Obscn	G	A	11: 59,031,591	T5921M	possibly damaging	Het
Olfr1221	T	C	2: 89,111,572		probably null	Het
Olfr676	T	C	7: 105,035,303	F35S	probably benign	Het
Pcdha11	C	A	18: 37,006,916	Q533K	possibly damaging	Het
Pgm5	T	C	19: 24,816,445	E285G	probably benign	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Rgs21	T	C	1: 144,519,875	T92A	possibly damaging	Het
Rgsl1	T	A	1: 153,827,536	Y123F	probably benign	Het
Rnf13	A	C	3: 57,820,589	K230T	probably damaging	Het
Smchd1	T	C	17: 71,407,235	T878A	probably benign	Het
Specc1	T	G	11: 62,151,827		probably null	Het
Tg	A	T	15: 66,707,942	Q1532L	probably damaging	Het
Timm44	A	C	8: 4,266,654	S297A	possibly damaging	Het
Txndc9	G	T	1: 37,995,790	S11*	probably null	Het
Uggt1	C	T	1: 36,146,668	W1478*	probably null	Het
Washc3	T	C	10: 88,216,031	V87A	probably benign	Het
Xlr5b	T	C	X: 73,157,898		probably null	Het

Other mutations in Sgf29

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Sgf29	APN	7	126664931	missense	possibly damaging	0.94
IGL02546:Sgf29	APN	7	126671853	missense	probably damaging	1.00
xiangfan	UTSW	7	126663938	missense	possibly damaging	0.90
R0280:Sgf29	UTSW	7	126671571	missense	probably benign	0.45
R1438:Sgf29	UTSW	7	126671891	splice site	probably null
R1987:Sgf29	UTSW	7	126649477	splice site	probably null
R4342:Sgf29	UTSW	7	126671777	missense	probably damaging	1.00
R4869:Sgf29	UTSW	7	126649375	unclassified	probably benign
R4928:Sgf29	UTSW	7	126664982	missense	probably damaging	1.00
R7122:Sgf29	UTSW	7	126672049	missense	probably null	0.44
R7319:Sgf29	UTSW	7	126671649	missense	probably benign	0.00
R7902:Sgf29	UTSW	7	126672178	missense	probably damaging	1.00
R8152:Sgf29	UTSW	7	126672654	missense	possibly damaging	0.46
R8395:Sgf29	UTSW	7	126672665	nonsense	probably null
R8509:Sgf29	UTSW	7	126671662	critical splice donor site	probably benign

Predicted Primers

PCR Primer
(F):5'- GAGCCAGTGGGGAGTATTTCAG -3'
(R):5'- ACTTTAGGTCACTCAGCCAAAAG -3'

Sequencing Primer
(F):5'- TTTGCCAAGTGAAAGATCCCG -3'
(R):5'- TAGGTCACTCAGCCAAAAGGAATAAC -3'

Posted On

2015-07-21