Incidental Mutation 'R4489:Kif1bp'
ID330639
Institutional Source Beutler Lab
Gene Symbol Kif1bp
Ensembl Gene ENSMUSG00000036955
Gene NameKIF1 binding protein
Synonyms2510003E04Rik
MMRRC Submission 041745-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4489 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location62538626-62578457 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 62563027 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065887] [ENSMUST00000159704] [ENSMUST00000162525] [ENSMUST00000162648] [ENSMUST00000162759]
Predicted Effect probably benign
Transcript: ENSMUST00000065887
SMART Domains Protein: ENSMUSP00000065160
Gene: ENSMUSG00000036955

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 1e-5 BLAST
Pfam:KBP_C 243 610 6.6e-124 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159704
SMART Domains Protein: ENSMUSP00000134770
Gene: ENSMUSG00000036955

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 1e-5 BLAST
Pfam:KBP_C 242 383 2.7e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162263
Predicted Effect probably benign
Transcript: ENSMUST00000162525
SMART Domains Protein: ENSMUSP00000125162
Gene: ENSMUSG00000036955

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 6e-6 BLAST
Pfam:KBP_C 242 293 5.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162648
Predicted Effect probably benign
Transcript: ENSMUST00000162759
SMART Domains Protein: ENSMUSP00000125236
Gene: ENSMUSG00000036955

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 1e-5 BLAST
Pfam:KBP_C 242 329 4.8e-28 PFAM
transmembrane domain 340 362 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208223
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 94% (50/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinesin family member 1 binding protein that is characterized by two tetratrico peptide repeats. The encoded protein localizes to the mitochondria and may be involved in regulating transport of the mitochondria. Mutations in this gene are associated with Goldberg-Shprintzen megacolon syndrome. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous KO mice die shortly after birth from respiratory failure. Knockout affects innervation of the digestive tract, and the development of the olfactory bulb and the anterior commissure in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,220,702 Y250H probably benign Het
4932438A13Rik A T 3: 37,003,933 Q3224L probably null Het
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Ank3 C T 10: 69,898,256 A754V probably damaging Het
Ano1 T C 7: 144,611,742 N582S probably benign Het
Arnt2 T A 7: 84,275,345 T425S probably benign Het
Cand2 A G 6: 115,789,466 D344G probably damaging Het
Clta T G 4: 44,032,417 F198V probably damaging Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Csmd2 G A 4: 128,381,945 V826M possibly damaging Het
Dnah11 C T 12: 117,916,896 V3830I probably benign Het
Fhl4 T C 10: 85,098,455 D154G possibly damaging Het
Gbp4 T A 5: 105,121,907 T352S probably damaging Het
Gigyf2 A G 1: 87,440,826 D1076G probably damaging Het
Gm21370 T A 13: 120,026,842 Y57F probably benign Het
Gm6489 A G 1: 31,287,239 noncoding transcript Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hectd4 T G 5: 121,286,257 I660R possibly damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Htr1b A T 9: 81,631,539 D338E probably benign Het
Lrp1b T C 2: 40,661,489 probably benign Het
Lzts1 T A 8: 69,135,695 K536N possibly damaging Het
Mrpl22 T A 11: 58,173,102 N49K probably benign Het
Mzt1 T C 14: 99,036,490 *42W probably null Het
Nkx3-2 T G 5: 41,761,961 Q228P probably damaging Het
Nufip2 T G 11: 77,686,229 M1R probably null Het
Obscn G A 11: 59,031,591 T5921M possibly damaging Het
Olfr1221 T C 2: 89,111,572 probably null Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Pcdha11 C A 18: 37,006,916 Q533K possibly damaging Het
Pgm5 T C 19: 24,816,445 E285G probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rgs21 T C 1: 144,519,875 T92A possibly damaging Het
Rgsl1 T A 1: 153,827,536 Y123F probably benign Het
Rnf13 A C 3: 57,820,589 K230T probably damaging Het
Sgf29 T C 7: 126,663,938 S29P possibly damaging Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Specc1 T G 11: 62,151,827 probably null Het
Tg A T 15: 66,707,942 Q1532L probably damaging Het
Timm44 A C 8: 4,266,654 S297A possibly damaging Het
Txndc9 G T 1: 37,995,790 S11* probably null Het
Uggt1 C T 1: 36,146,668 W1478* probably null Het
Washc3 T C 10: 88,216,031 V87A probably benign Het
Xlr5b T C X: 73,157,898 probably null Het
Other mutations in Kif1bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Kif1bp APN 10 62559339 nonsense probably null
IGL02127:Kif1bp APN 10 62578349 missense probably benign 0.00
IGL03304:Kif1bp APN 10 62559303 missense probably damaging 1.00
IGL02980:Kif1bp UTSW 10 62559168 missense probably damaging 1.00
R0317:Kif1bp UTSW 10 62578082 splice site probably null
R0408:Kif1bp UTSW 10 62566053 missense probably benign 0.37
R0462:Kif1bp UTSW 10 62559456 missense probably damaging 1.00
R1469:Kif1bp UTSW 10 62559450 missense probably damaging 0.96
R1469:Kif1bp UTSW 10 62559450 missense probably damaging 0.96
R1503:Kif1bp UTSW 10 62559408 missense probably damaging 0.98
R1830:Kif1bp UTSW 10 62559327 missense probably damaging 1.00
R3848:Kif1bp UTSW 10 62569470 missense probably damaging 1.00
R4486:Kif1bp UTSW 10 62563027 intron probably benign
R4488:Kif1bp UTSW 10 62563027 intron probably benign
R5137:Kif1bp UTSW 10 62578241 missense probably damaging 1.00
R5193:Kif1bp UTSW 10 62559396 missense possibly damaging 0.81
R5212:Kif1bp UTSW 10 62563129 intron probably benign
R5929:Kif1bp UTSW 10 62559402 missense probably damaging 1.00
R6179:Kif1bp UTSW 10 62563250 nonsense probably null
R6488:Kif1bp UTSW 10 62559658 splice site probably null
R6513:Kif1bp UTSW 10 62575034 splice site probably null
R6808:Kif1bp UTSW 10 62575144 missense possibly damaging 0.90
R6900:Kif1bp UTSW 10 62559129 missense probably damaging 1.00
R6916:Kif1bp UTSW 10 62566064 missense probably benign 0.05
R7092:Kif1bp UTSW 10 62578300 missense probably damaging 1.00
R7289:Kif1bp UTSW 10 62566116 missense probably damaging 1.00
R7376:Kif1bp UTSW 10 62559064 missense possibly damaging 0.89
R7672:Kif1bp UTSW 10 62578073 missense probably benign 0.00
R8134:Kif1bp UTSW 10 62577977 missense probably benign
R8809:Kif1bp UTSW 10 62559712 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CCGGCTTAGACTACAGAGAGAC -3'
(R):5'- CTCATCATCAGGCCCACTATGTG -3'

Sequencing Primer
(F):5'- TCCATCAGGAAAGTGCCAG -3'
(R):5'- ATCAGGCCCACTATGTGTTTTG -3'
Posted On2015-07-21