Mutagenetix > Incidental Mutations

Incidental Mutation 'R0052:Bicd2'

33065

Institutional Source

Beutler Lab

Gene Symbol

Bicd2

Ensembl Gene

ENSMUSG00000037933

Gene Name

BICD cargo adaptor 2

Synonyms

0610027D24Rik, 1110005D12Rik

MMRRC Submission

038346-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.623) question?

Stock #

R0052 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

49341585-49387026 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 49375314 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 184 (L184Q)

Ref Sequence

ENSEMBL: ENSMUSP00000105712 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048544] [ENSMUST00000110084] [ENSMUST00000110085]

Predicted Effect

probably damaging
Transcript: ENSMUST00000048544
AA Change: L184Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039394
Gene: ENSMUSG00000037933
AA Change: L184Q

Domain	Start	End	E-Value	Type
internal_repeat_1	22	50	2.25e-5	PROSPERO
Pfam:BicD	83	797	N/A	PFAM
low complexity region	807	819	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110084
AA Change: L110Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105711
Gene: ENSMUSG00000037933
AA Change: L110Q

Domain	Start	End	E-Value	Type
Pfam:BicD	9	723	N/A	PFAM
low complexity region	733	745	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110085
AA Change: L184Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105712
Gene: ENSMUSG00000037933
AA Change: L184Q

Domain	Start	End	E-Value	Type
internal_repeat_1	22	50	1.16e-5	PROSPERO
Pfam:BicD	83	797	N/A	PFAM
low complexity region	807	819	N/A	INTRINSIC

Meta Mutation Damage Score

0.9510

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.2%

Validation Efficiency

97% (65/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of two human homologs of Drosophila bicaudal-D and a member of the Bicoid family. It has been implicated in dynein-mediated, minus end-directed motility along microtubules. It has also been reported to be a phosphorylation target of NIMA related kinase 8. Two alternative splice variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show postnatal and premature death associated with progressive hydrocephalus, enlarged lateral ventricles, aqueductal stenosis, abnormal gait, disrupted laminar organization of the cerebral cortex and cerebellum, and impaired cerebellar granule cell migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apba1	T	C	19: 23,915,951	S438P	possibly damaging	Het
Atp2a1	A	G	7: 126,457,897		probably benign	Het
Axin2	T	C	11: 108,949,270	Y735H	probably damaging	Het
Bub1	G	A	2: 127,809,039	T618I	probably benign	Het
Catsperg2	A	G	7: 29,725,020		probably benign	Het
Ccdc73	T	A	2: 104,929,570		probably benign	Het
Crybg3	A	T	16: 59,565,656		probably benign	Het
Dsp	A	G	13: 38,197,364	D2096G	possibly damaging	Het
Eef2	C	CN	10: 81,178,768		probably null	Het
Elp3	A	G	14: 65,531,526	*548Q	probably null	Het
Eno4	A	G	19: 58,968,553	D357G	probably damaging	Het
Fam214a	A	G	9: 75,018,983		probably benign	Het
Fcrls	A	T	3: 87,256,778	I348N	possibly damaging	Het
Fgl2	A	T	5: 21,375,349	S230C	probably damaging	Het
Ginm1	T	A	10: 7,779,306	E57D	possibly damaging	Het
Gtf3c1	A	T	7: 125,667,971		probably null	Het
Herc1	G	T	9: 66,400,156	G1044V	probably damaging	Het
Hmcn1	G	A	1: 150,677,406	T2511M	probably damaging	Het
Iba57	C	T	11: 59,158,901	A207T	probably benign	Het
Itga9	T	A	9: 118,636,549	I157N	probably damaging	Het
Kalrn	A	G	16: 34,357,171	L208P	probably damaging	Het
Kcnj10	A	G	1: 172,368,924	T2A	probably benign	Het
Kdm1b	T	A	13: 47,064,117	C351S	probably damaging	Het
Kif21a	T	C	15: 90,970,857	E700G	probably damaging	Het
Mmd	C	T	11: 90,259,998		probably benign	Het
Mocs3	C	T	2: 168,231,682	P350S	probably benign	Het
Morn3	T	C	5: 123,046,663	Y38C	probably damaging	Het
Nacc1	A	T	8: 84,676,225	V313D	probably benign	Het
Nbeal1	T	A	1: 60,228,612		probably benign	Het
Neb	T	C	2: 52,273,980	K1989E	possibly damaging	Het
Nlrp3	C	T	11: 59,565,128	R917*	probably null	Het
Nlrp4b	T	A	7: 10,725,962	Y463*	probably null	Het
Perm1	A	T	4: 156,218,115	D372V	probably damaging	Het
Phf3	T	C	1: 30,808,767	T1232A	probably damaging	Het
Phldb3	G	A	7: 24,612,579	R106Q	probably benign	Het
Pld4	T	A	12: 112,767,857	F386I	probably benign	Het
Prex2	T	A	1: 11,160,156	L802Q	probably damaging	Het
Psd3	A	G	8: 67,882,979		probably null	Het
Ralgds	T	A	2: 28,544,388		probably null	Het
Rmdn2	A	G	17: 79,650,331	E16G	probably damaging	Het
Rnf111	A	T	9: 70,476,389	S87R	probably benign	Het
Slc4a4	A	C	5: 89,156,336	H502P	possibly damaging	Het
Slc9c1	A	G	16: 45,606,856		probably benign	Het
Slco3a1	A	T	7: 74,504,326	I166N	probably benign	Het
Snx5	A	T	2: 144,259,192		probably null	Het
Srgap1	T	C	10: 121,800,827	D741G	possibly damaging	Het
St8sia2	G	T	7: 73,943,290	Y339*	probably null	Het
St8sia2	A	T	7: 73,971,952	W86R	probably damaging	Het
Stk33	A	G	7: 109,279,669	L491P	possibly damaging	Het
Sult2a7	T	C	7: 14,465,208	Y298C	probably damaging	Het
Tdo2	T	A	3: 81,967,025	N210I	probably benign	Het
Thada	A	T	17: 84,455,158	N104K	probably damaging	Het
Timm8b	A	T	9: 50,605,030	D61V	possibly damaging	Het
Tshz1	G	A	18: 84,014,945	T446I	possibly damaging	Het
Ubap2l	T	C	3: 90,038,928	N123S	possibly damaging	Het
Vmn1r48	T	C	6: 90,036,264	E193G	possibly damaging	Het
Vmn1r69	C	T	7: 10,580,400	V135I	probably benign	Het
Vmn2r103	G	T	17: 19,811,641	G559V	probably benign	Het
Vmn2r26	T	A	6: 124,062,033	*856R	probably null	Het
Vmn2r88	A	G	14: 51,418,700	I798V	possibly damaging	Het
Vsir	C	T	10: 60,358,082	A108V	probably benign	Het
Zfp14	G	T	7: 30,038,328	Q411K	probably damaging	Het
Zfp236	A	T	18: 82,639,332	M762K	probably damaging	Het
Zfp462	G	A	4: 55,011,762	G1243S	probably benign	Het

Other mutations in Bicd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01070:Bicd2	APN	13	49378316	missense	probably damaging	1.00
IGL02029:Bicd2	APN	13	49369499	missense	probably damaging	1.00
IGL02052:Bicd2	APN	13	49379189	missense	possibly damaging	0.91
IGL02955:Bicd2	APN	13	49378215	missense	probably benign
IGL03033:Bicd2	APN	13	49379920	missense	probably benign	0.09
IGL03395:Bicd2	APN	13	49375258	missense	probably damaging	1.00
IGL02802:Bicd2	UTSW	13	49378328	missense	probably damaging	1.00
P0027:Bicd2	UTSW	13	49379651	missense	probably benign	0.05
R0052:Bicd2	UTSW	13	49375314	missense	probably damaging	1.00
R0393:Bicd2	UTSW	13	49379870	missense	probably damaging	1.00
R0718:Bicd2	UTSW	13	49377875	splice site	probably null
R0730:Bicd2	UTSW	13	49378241	missense	possibly damaging	0.77
R1716:Bicd2	UTSW	13	49378310	missense	probably benign
R2004:Bicd2	UTSW	13	49379405	missense	possibly damaging	0.50
R2041:Bicd2	UTSW	13	49341776	missense	probably benign	0.02
R2151:Bicd2	UTSW	13	49379576	missense	probably damaging	1.00
R2152:Bicd2	UTSW	13	49379576	missense	probably damaging	1.00
R2444:Bicd2	UTSW	13	49379024	missense	probably benign	0.00
R4085:Bicd2	UTSW	13	49384962	splice site	probably null
R4477:Bicd2	UTSW	13	49377972	missense	probably damaging	1.00
R4824:Bicd2	UTSW	13	49379012	missense	probably damaging	1.00
R4979:Bicd2	UTSW	13	49379464	missense	possibly damaging	0.89
R6348:Bicd2	UTSW	13	49379846	missense	probably damaging	1.00
R7317:Bicd2	UTSW	13	49378308	missense	probably damaging	1.00
R7326:Bicd2	UTSW	13	49369609	missense	probably benign	0.43
R7395:Bicd2	UTSW	13	49378230	missense	possibly damaging	0.79
R7448:Bicd2	UTSW	13	49379951	missense	probably damaging	1.00
R7789:Bicd2	UTSW	13	49379659	missense	probably damaging	1.00
T0722:Bicd2	UTSW	13	49379651	missense	probably benign	0.05
X0003:Bicd2	UTSW	13	49379651	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TCCAGACAGCCATATTGTTGCCC -3'
(R):5'- AGATGCTGTGAGCTTTGATTCCCC -3'

Sequencing Primer
(F):5'- GCCATATTGTTGCCCAAAGG -3'
(R):5'- GATTCCCCTGTCTCCACTGTG -3'

Posted On

2013-05-09