Incidental Mutation 'R4489:Pcdha11'
ID330655
Institutional Source Beutler Lab
Gene Symbol Pcdha11
Ensembl Gene ENSMUSG00000102206
Gene Nameprotocadherin alpha 11
SynonymsA830022B16Rik, Crnr7, Cnr7
MMRRC Submission 041745-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R4489 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37010712-37187657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 37006916 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 533 (Q533K)
Ref Sequence ENSEMBL: ENSMUSP00000111322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115657] [ENSMUST00000115658] [ENSMUST00000115659] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000192168] [ENSMUST00000192295] [ENSMUST00000192447] [ENSMUST00000192503] [ENSMUST00000192512] [ENSMUST00000192631] [ENSMUST00000193389] [ENSMUST00000193777] [ENSMUST00000193839] [ENSMUST00000194038] [ENSMUST00000194544] [ENSMUST00000194751] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097612
Predicted Effect probably benign
Transcript: ENSMUST00000115657
SMART Domains Protein: ENSMUSP00000111321
Gene: ENSMUSG00000102206

DomainStartEndE-ValueType
CA 21 131 2.95e-2 SMART
CA 155 240 7.44e-19 SMART
CA 264 347 5.63e-28 SMART
CA 371 452 3.14e-26 SMART
CA 476 562 1.42e-24 SMART
CA 593 675 1.03e-12 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
low complexity region 918 942 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115658
AA Change: Q533K

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111322
Gene: ENSMUSG00000007440
AA Change: Q533K

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
CA 46 132 6.34e-2 SMART
CA 156 241 4.65e-20 SMART
CA 265 349 1.25e-25 SMART
CA 373 454 9.22e-24 SMART
CA 478 564 4.3e-24 SMART
CA 595 678 5.07e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 795 929 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115659
SMART Domains Protein: ENSMUSP00000111323
Gene: ENSMUSG00000103770

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
CA 75 161 2.46e-2 SMART
CA 185 270 8.1e-20 SMART
CA 294 378 1.69e-22 SMART
CA 402 483 1.52e-24 SMART
CA 507 593 5.68e-24 SMART
CA 624 705 6.69e-12 SMART
transmembrane domain 727 749 N/A INTRINSIC
Pfam:Cadherin_tail 828 962 5.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192168
SMART Domains Protein: ENSMUSP00000142293
Gene: ENSMUSG00000103092

DomainStartEndE-ValueType
CA 21 131 2.2e-2 SMART
CA 155 240 2.05e-21 SMART
CA 264 348 8.81e-21 SMART
CA 372 453 2.01e-24 SMART
CA 477 563 1.42e-24 SMART
CA 591 673 1.63e-15 SMART
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192295
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192447
SMART Domains Protein: ENSMUSP00000142270
Gene: ENSMUSG00000102206

DomainStartEndE-ValueType
CA 21 131 1.5e-4 SMART
CA 155 240 3.6e-21 SMART
CA 264 347 2.8e-30 SMART
CA 371 452 1.5e-28 SMART
CA 476 562 6.8e-27 SMART
CA 593 675 4.9e-15 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192512
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192631
SMART Domains Protein: ENSMUSP00000142156
Gene: ENSMUSG00000104318

DomainStartEndE-ValueType
CA 21 131 2.58e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 1.42e-24 SMART
CA 372 453 9.36e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 671 4.03e-6 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 905 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193389
SMART Domains Protein: ENSMUSP00000141459
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193777
SMART Domains Protein: ENSMUSP00000141587
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194038
SMART Domains Protein: ENSMUSP00000142159
Gene: ENSMUSG00000103800

DomainStartEndE-ValueType
CA 20 131 6.34e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 2.04e-25 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 9.88e-24 SMART
CA 594 676 8.62e-15 SMART
transmembrane domain 699 721 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194050
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194691
Predicted Effect probably benign
Transcript: ENSMUST00000194751
SMART Domains Protein: ENSMUSP00000142285
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Pfam:Cadherin_2 29 112 4.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 94% (50/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,220,702 Y250H probably benign Het
4932438A13Rik A T 3: 37,003,933 Q3224L probably null Het
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Ank3 C T 10: 69,898,256 A754V probably damaging Het
Ano1 T C 7: 144,611,742 N582S probably benign Het
Arnt2 T A 7: 84,275,345 T425S probably benign Het
Cand2 A G 6: 115,789,466 D344G probably damaging Het
Clta T G 4: 44,032,417 F198V probably damaging Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Csmd2 G A 4: 128,381,945 V826M possibly damaging Het
Dnah11 C T 12: 117,916,896 V3830I probably benign Het
Fhl4 T C 10: 85,098,455 D154G possibly damaging Het
Gbp4 T A 5: 105,121,907 T352S probably damaging Het
Gigyf2 A G 1: 87,440,826 D1076G probably damaging Het
Gm21370 T A 13: 120,026,842 Y57F probably benign Het
Gm6489 A G 1: 31,287,239 noncoding transcript Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hectd4 T G 5: 121,286,257 I660R possibly damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Htr1b A T 9: 81,631,539 D338E probably benign Het
Kif1bp A G 10: 62,563,027 probably benign Het
Lrp1b T C 2: 40,661,489 probably benign Het
Lzts1 T A 8: 69,135,695 K536N possibly damaging Het
Mrpl22 T A 11: 58,173,102 N49K probably benign Het
Mzt1 T C 14: 99,036,490 *42W probably null Het
Nkx3-2 T G 5: 41,761,961 Q228P probably damaging Het
Nufip2 T G 11: 77,686,229 M1R probably null Het
Obscn G A 11: 59,031,591 T5921M possibly damaging Het
Olfr1221 T C 2: 89,111,572 probably null Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Pgm5 T C 19: 24,816,445 E285G probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rgs21 T C 1: 144,519,875 T92A possibly damaging Het
Rgsl1 T A 1: 153,827,536 Y123F probably benign Het
Rnf13 A C 3: 57,820,589 K230T probably damaging Het
Sgf29 T C 7: 126,663,938 S29P possibly damaging Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Specc1 T G 11: 62,151,827 probably null Het
Tg A T 15: 66,707,942 Q1532L probably damaging Het
Timm44 A C 8: 4,266,654 S297A possibly damaging Het
Txndc9 G T 1: 37,995,790 S11* probably null Het
Uggt1 C T 1: 36,146,668 W1478* probably null Het
Washc3 T C 10: 88,216,031 V87A probably benign Het
Xlr5b T C X: 73,157,898 probably null Het
Other mutations in Pcdha11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Pcdha11 APN 18 37185008 missense probably damaging 1.00
IGL01843:Pcdha11 APN 18 37012833 missense probably benign 0.28
R1165:Pcdha11 UTSW 18 37007704 intron probably benign
R2422:Pcdha11 UTSW 18 37007272 missense probably damaging 0.99
R2423:Pcdha11 UTSW 18 37007424 missense possibly damaging 0.89
R2508:Pcdha11 UTSW 18 37012854 missense possibly damaging 0.86
R3114:Pcdha11 UTSW 18 37011807 missense probably damaging 1.00
R4173:Pcdha11 UTSW 18 37012623 missense probably damaging 0.99
R4255:Pcdha11 UTSW 18 37012790 missense probably benign 0.23
R4369:Pcdha11 UTSW 18 37006743 missense possibly damaging 0.70
R4454:Pcdha11 UTSW 18 37007373 missense probably benign 0.13
R4626:Pcdha11 UTSW 18 37006998 missense probably damaging 1.00
R4751:Pcdha11 UTSW 18 37006944 missense probably damaging 1.00
R4801:Pcdha11 UTSW 18 37005465 missense probably damaging 1.00
R4802:Pcdha11 UTSW 18 37005465 missense probably damaging 1.00
R4857:Pcdha11 UTSW 18 37011452 missense probably benign 0.02
R4995:Pcdha11 UTSW 18 37011027 missense probably benign 0.24
R5042:Pcdha11 UTSW 18 37011596 missense probably damaging 1.00
R5480:Pcdha11 UTSW 18 37005882 missense probably benign 0.04
R5495:Pcdha11 UTSW 18 37011026 missense probably benign
R5523:Pcdha11 UTSW 18 37012386 missense probably damaging 1.00
R5584:Pcdha11 UTSW 18 37006765 missense probably damaging 1.00
R5682:Pcdha11 UTSW 18 37011449 missense probably damaging 1.00
R5834:Pcdha11 UTSW 18 37012623 missense probably damaging 0.99
R5842:Pcdha11 UTSW 18 37011284 missense possibly damaging 0.85
R5859:Pcdha11 UTSW 18 37007283 missense probably damaging 1.00
R6110:Pcdha11 UTSW 18 37011456 missense probably damaging 1.00
R6135:Pcdha11 UTSW 18 37005817 missense probably damaging 1.00
R6248:Pcdha11 UTSW 18 37005897 missense probably benign 0.26
R6416:Pcdha11 UTSW 18 37012169 unclassified probably null
R6450:Pcdha11 UTSW 18 37013162 missense probably damaging 1.00
R6594:Pcdha11 UTSW 18 37011182 missense probably benign 0.04
R6631:Pcdha11 UTSW 18 37005791 missense probably damaging 1.00
R6883:Pcdha11 UTSW 18 37011189 missense probably damaging 1.00
R7088:Pcdha11 UTSW 18 37005417 missense probably benign 0.00
R7129:Pcdha11 UTSW 18 37007238 missense probably benign 0.45
R7153:Pcdha11 UTSW 18 37011225 missense probably damaging 1.00
R7244:Pcdha11 UTSW 18 37011368 nonsense probably null
R7295:Pcdha11 UTSW 18 37006926 missense probably damaging 1.00
R7319:Pcdha11 UTSW 18 37013192 missense probably benign 0.10
R7352:Pcdha11 UTSW 18 37006845 missense probably damaging 1.00
R7516:Pcdha11 UTSW 18 37011618 missense probably damaging 1.00
R7519:Pcdha11 UTSW 18 37006266 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGCACGTCTTCACAGTATTG -3'
(R):5'- GCATTGTAACCAGAGTCCGC -3'

Sequencing Primer
(F):5'- CACGTCTTCACAGTATTGGCGATG -3'
(R):5'- TGTAACCAGAGTCCGCATCTACTG -3'
Posted On2015-07-21