Incidental Mutation 'R4489:Pgm5'
ID330656
Institutional Source Beutler Lab
Gene Symbol Pgm5
Ensembl Gene ENSMUSG00000041731
Gene Namephosphoglucomutase 5
Synonyms9530034F03Rik, aciculin
MMRRC Submission 041745-MU
Accession Numbers

Genbank: NM_175013

Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R4489 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location24683016-24861855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24816445 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 285 (E285G)
Ref Sequence ENSEMBL: ENSMUSP00000036025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047666]
Predicted Effect probably benign
Transcript: ENSMUST00000047666
AA Change: E285G

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000036025
Gene: ENSMUSG00000041731
AA Change: E285G

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 19 163 3.9e-31 PFAM
Pfam:PGM_PMM_II 198 306 1.8e-15 PFAM
Pfam:PGM_PMM_III 311 425 6.9e-31 PFAM
SCOP:d3pmga4 427 567 5e-74 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129127
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150339
Meta Mutation Damage Score 0.0770 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 94% (50/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoglucomutases (EC 5.2.2.2.), such as PGM5, are phosphotransferases involved in interconversion of glucose-1-phosphate and glucose-6-phosphate. PGM activity is essential in formation of carbohydrates from glucose-6-phosphate and in formation of glucose-6-phosphate from galactose and glycogen (Edwards et al., 1995 [PubMed 8586438]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,220,702 Y250H probably benign Het
4932438A13Rik A T 3: 37,003,933 Q3224L probably null Het
Abcd2 A G 15: 91,178,283 V484A probably damaging Het
Ank3 C T 10: 69,898,256 A754V probably damaging Het
Ano1 T C 7: 144,611,742 N582S probably benign Het
Arnt2 T A 7: 84,275,345 T425S probably benign Het
Cand2 A G 6: 115,789,466 D344G probably damaging Het
Clta T G 4: 44,032,417 F198V probably damaging Het
Cnga2 T A X: 72,006,127 F133I possibly damaging Het
Csmd2 G A 4: 128,381,945 V826M possibly damaging Het
Dnah11 C T 12: 117,916,896 V3830I probably benign Het
Fhl4 T C 10: 85,098,455 D154G possibly damaging Het
Gbp4 T A 5: 105,121,907 T352S probably damaging Het
Gigyf2 A G 1: 87,440,826 D1076G probably damaging Het
Gm21370 T A 13: 120,026,842 Y57F probably benign Het
Gm6489 A G 1: 31,287,239 noncoding transcript Het
Grm6 T C 11: 50,859,989 S660P probably damaging Het
Hectd4 T G 5: 121,286,257 I660R possibly damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Htr1b A T 9: 81,631,539 D338E probably benign Het
Kif1bp A G 10: 62,563,027 probably benign Het
Lrp1b T C 2: 40,661,489 probably benign Het
Lzts1 T A 8: 69,135,695 K536N possibly damaging Het
Mrpl22 T A 11: 58,173,102 N49K probably benign Het
Mzt1 T C 14: 99,036,490 *42W probably null Het
Nkx3-2 T G 5: 41,761,961 Q228P probably damaging Het
Nufip2 T G 11: 77,686,229 M1R probably null Het
Obscn G A 11: 59,031,591 T5921M possibly damaging Het
Olfr1221 T C 2: 89,111,572 probably null Het
Olfr676 T C 7: 105,035,303 F35S probably benign Het
Pcdha11 C A 18: 37,006,916 Q533K possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rgs21 T C 1: 144,519,875 T92A possibly damaging Het
Rgsl1 T A 1: 153,827,536 Y123F probably benign Het
Rnf13 A C 3: 57,820,589 K230T probably damaging Het
Sgf29 T C 7: 126,663,938 S29P possibly damaging Het
Smchd1 T C 17: 71,407,235 T878A probably benign Het
Specc1 T G 11: 62,151,827 probably null Het
Tg A T 15: 66,707,942 Q1532L probably damaging Het
Timm44 A C 8: 4,266,654 S297A possibly damaging Het
Txndc9 G T 1: 37,995,790 S11* probably null Het
Uggt1 C T 1: 36,146,668 W1478* probably null Het
Washc3 T C 10: 88,216,031 V87A probably benign Het
Xlr5b T C X: 73,157,898 probably null Het
Other mutations in Pgm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Pgm5 APN 19 24834766 missense possibly damaging 0.65
IGL01318:Pgm5 APN 19 24816478 missense probably damaging 1.00
IGL01372:Pgm5 APN 19 24733621 missense probably damaging 1.00
IGL01541:Pgm5 APN 19 24816413 missense probably damaging 1.00
IGL01648:Pgm5 APN 19 24824351 missense probably damaging 0.99
IGL02049:Pgm5 APN 19 24824418 missense probably benign 0.00
IGL02827:Pgm5 APN 19 24709295 missense probably benign 0.16
IGL02975:Pgm5 APN 19 24834848 missense probably benign 0.00
3-1:Pgm5 UTSW 19 24727788 missense probably benign 0.02
P0047:Pgm5 UTSW 19 24816421 missense probably damaging 1.00
PIT4466001:Pgm5 UTSW 19 24824329 missense probably damaging 1.00
R0013:Pgm5 UTSW 19 24733540 critical splice donor site probably null
R0047:Pgm5 UTSW 19 24684556 missense probably damaging 0.98
R0180:Pgm5 UTSW 19 24815763 missense probably damaging 1.00
R0317:Pgm5 UTSW 19 24824399 missense possibly damaging 0.55
R0478:Pgm5 UTSW 19 24834869 missense possibly damaging 0.45
R1587:Pgm5 UTSW 19 24815749 missense probably damaging 1.00
R2017:Pgm5 UTSW 19 24824312 missense probably benign 0.06
R2087:Pgm5 UTSW 19 24733563 missense probably damaging 0.99
R2152:Pgm5 UTSW 19 24834815 missense probably damaging 1.00
R2169:Pgm5 UTSW 19 24834815 missense probably damaging 1.00
R3851:Pgm5 UTSW 19 24820203 missense probably damaging 1.00
R4034:Pgm5 UTSW 19 24861657 missense probably damaging 0.96
R4630:Pgm5 UTSW 19 24834746 nonsense probably null
R4736:Pgm5 UTSW 19 24834805 missense probably damaging 1.00
R5186:Pgm5 UTSW 19 24820128 missense probably damaging 1.00
R5414:Pgm5 UTSW 19 24709325 missense probably damaging 0.99
R5558:Pgm5 UTSW 19 24824451 splice site probably null
R5617:Pgm5 UTSW 19 24750401 nonsense probably null
R6142:Pgm5 UTSW 19 24824408 missense probably damaging 1.00
R6648:Pgm5 UTSW 19 24861632 missense probably benign 0.02
R6821:Pgm5 UTSW 19 24861647 missense possibly damaging 0.88
R7360:Pgm5 UTSW 19 24834817 missense probably damaging 1.00
R7421:Pgm5 UTSW 19 24709299 missense probably benign 0.03
R7590:Pgm5 UTSW 19 24709265 missense probably damaging 1.00
R7610:Pgm5 UTSW 19 24834756 missense probably damaging 1.00
R7685:Pgm5 UTSW 19 24727851 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- TTATCTAGCACTGAACGGCCG -3'
(R):5'- AAACACCCAGGGAAGAGTATTC -3'

Sequencing Primer
(F):5'- CCAGTCTCTGGTTTCTGA -3'
(R):5'- CCGCAATAAACTGTGTCC -3'
Posted On2015-07-21