Incidental Mutation 'R4490:Gbp2'
ID330670
Institutional Source Beutler Lab
Gene Symbol Gbp2
Ensembl Gene ENSMUSG00000028270
Gene Nameguanylate binding protein 2
Synonyms
MMRRC Submission 041746-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4490 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location142620602-142638008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142623764 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 24 (N24S)
Ref Sequence ENSEMBL: ENSMUSP00000129039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029936] [ENSMUST00000165774] [ENSMUST00000169572]
Predicted Effect probably benign
Transcript: ENSMUST00000029936
SMART Domains Protein: ENSMUSP00000029936
Gene: ENSMUSG00000040264

DomainStartEndE-ValueType
Pfam:GBP 18 280 4.1e-122 PFAM
Pfam:GBP_C 282 578 5.5e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165774
AA Change: N24S

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132435
Gene: ENSMUSG00000028270
AA Change: N24S

DomainStartEndE-ValueType
Pfam:GBP 18 280 7.5e-124 PFAM
Pfam:GBP_C 282 578 1.3e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169572
AA Change: N24S

PolyPhen 2 Score 0.302 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129039
Gene: ENSMUSG00000028270
AA Change: N24S

DomainStartEndE-ValueType
Pfam:GBP 18 115 3.1e-49 PFAM
Pfam:MMR_HSR1 40 116 1.3e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183426
Meta Mutation Damage Score 0.3435 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the guanine-binding protein (GBP) family, which includes interferon-induced proteins that can bind to guanine nucleotides (GMP, GDP and GTP). The encoded protein is a GTPase which hydrolyzes GTP, predominantly to GDP. The protein may play a role as a marker of squamous cell carcinomas. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to increased susceptibility to chronic Toxoplasma gondii infection, characterized by an increased parasite burden in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T C 1: 156,633,779 V417A probably damaging Het
Adgrb2 T C 4: 130,012,328 V881A possibly damaging Het
Arl5c G A 11: 97,995,836 R10* probably null Het
Atad1 A G 19: 32,695,797 C229R probably benign Het
Atp6v0a2 T C 5: 124,646,734 V319A probably damaging Het
Cage1 A G 13: 38,023,417 S257P possibly damaging Het
Ccndbp1 A G 2: 121,012,395 D179G probably damaging Het
Cngb3 T C 4: 19,415,684 I398T probably benign Het
Crmp1 A G 5: 37,276,331 D178G probably damaging Het
Csmd3 C T 15: 48,314,033 V370I possibly damaging Het
Dapk1 A G 13: 60,718,128 T180A probably benign Het
Dmtf1 A G 5: 9,140,379 probably benign Het
Dnah12 T C 14: 26,734,603 L827S possibly damaging Het
F5 T C 1: 164,217,395 V2084A probably benign Het
Fan1 A T 7: 64,369,180 S476T possibly damaging Het
Far2 T C 6: 148,173,409 L380P possibly damaging Het
Gm14325 T C 2: 177,832,983 H101R possibly damaging Het
Gpr55 C T 1: 85,941,818 V14M probably damaging Het
Herc6 A T 6: 57,654,495 Y724F probably damaging Het
Impg1 T A 9: 80,394,059 Q195L probably damaging Het
Inf2 T C 12: 112,600,204 F68L probably damaging Het
Kcnh8 T C 17: 52,961,877 probably null Het
Klb A G 5: 65,375,794 N482S probably benign Het
Kpnb1 A G 11: 97,171,598 V447A probably benign Het
Nckap5l G A 15: 99,426,130 P831S probably benign Het
Ncor2 A G 5: 125,036,815 probably null Het
Olfr32 A T 2: 90,138,917 V74D probably damaging Het
Pgm3 T C 9: 86,561,840 Y337C probably damaging Het
Prdm1 G T 10: 44,446,907 Y197* probably null Het
Prdm4 A T 10: 85,900,899 C626S probably damaging Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Ranbp6 A G 19: 29,810,333 L873P probably damaging Het
Rin2 A G 2: 145,822,274 T23A possibly damaging Het
Rxra G T 2: 27,741,195 R118L probably damaging Het
Spice1 T C 16: 44,382,113 L750P probably damaging Het
Trpm1 C T 7: 64,208,912 Q228* probably null Het
Tsc1 A G 2: 28,670,925 D265G probably damaging Het
Usp29 T C 7: 6,961,950 I264T possibly damaging Het
Vmn2r26 T C 6: 124,050,738 L479P possibly damaging Het
Zfp9 A G 6: 118,465,312 S130P probably benign Het
Other mutations in Gbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Gbp2 APN 3 142633480 missense probably damaging 1.00
IGL02055:Gbp2 APN 3 142632230 missense probably benign 0.16
IGL03024:Gbp2 APN 3 142632019 missense probably damaging 1.00
P4717OSA:Gbp2 UTSW 3 142630596 missense possibly damaging 0.63
PIT4445001:Gbp2 UTSW 3 142637466 missense probably benign
R0267:Gbp2 UTSW 3 142630106 missense probably benign 0.00
R0507:Gbp2 UTSW 3 142630033 missense probably damaging 1.00
R0601:Gbp2 UTSW 3 142630758 missense possibly damaging 0.47
R1005:Gbp2 UTSW 3 142630501 splice site probably benign
R1006:Gbp2 UTSW 3 142637422 missense probably damaging 1.00
R1795:Gbp2 UTSW 3 142630523 missense possibly damaging 0.61
R1893:Gbp2 UTSW 3 142630172 splice site probably benign
R2398:Gbp2 UTSW 3 142633362 missense probably benign 0.01
R3978:Gbp2 UTSW 3 142629986 missense possibly damaging 0.88
R4095:Gbp2 UTSW 3 142637449 missense probably benign
R5799:Gbp2 UTSW 3 142632082 missense probably benign
R5834:Gbp2 UTSW 3 142633377 missense probably damaging 0.98
R6159:Gbp2 UTSW 3 142632257 missense probably damaging 0.99
R6237:Gbp2 UTSW 3 142632032 missense probably benign
R6494:Gbp2 UTSW 3 142632008 missense probably damaging 0.98
R6982:Gbp2 UTSW 3 142630085 missense probably damaging 1.00
R7190:Gbp2 UTSW 3 142633447 missense probably benign 0.15
Z1088:Gbp2 UTSW 3 142630015 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGGGCTCCAAAACTCTTAGAAG -3'
(R):5'- ACATCTGCTTTCAGGATGCTGG -3'

Sequencing Primer
(F):5'- GGGCTCCAAAACTCTTAGAAGTGTAC -3'
(R):5'- TGCTGGTGACATGAGTGAAC -3'
Posted On2015-07-21